| IGR sequence: | igr140#chr1#x1=582220#l=2039 |
|---|---|
| Mature miRNA sequence: | CUUCAUCUUCAUCAUCAUCAG |
| encoded miRNA: | MIR39 |
| Precursor location: | 509 - 583 (positive strand) |
| precursor length: | 75 (26 basepairs) |
| MIR position: | 1 - 21 (509 - 529) |
| MIR length: | 21 (17 paired bases) |
| miRNA location TIGR v3: | chr1:582728>582802 |
| miRNA location TIGR v5: | chr1:582728>582802 |
| Folding energy: | -32.90 |
| BLAST hit against RFAM Atha miRNAs: | none |
| Belongs to miRNAs-targets cluster: | cluster022 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** *
CUUCAUCUUC AUCAUCAUCA GGAAUCUCGG GAUAUGGAUC AGCCAUGUCC UUAUAUGAUG 60
(((((((--- (((((((((( --------(( (((((((___ __)))))))) )----)))))
AUGAUAUUGA UGAGG 75
)))))---)) )))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
| Nr. | Gene | Description | mismatches | miRNAs |
|---|---|---|---|---|
| 1 | At1g06900.1 | 68408.m00666 expressed protein | 2 | 1 |
| 2 | At1g11440.1 | 68408.m01182 serine/threonine protein kinase emb|CAA69216 -related | 2 | 1 |
| 3 | At1g12070.1 | 68408.m01255 GDP-dissociation inhibitor -related | 2 | 1 |
| 4 | At1g12830.1 | 68408.m01346 peroxisomal targeting signal type 2 receptor | 2 | 1 |
| 5 | At1g29240.1 | 68408.m03236 expressed protein | 2 | 1 |
| 6 | At1g32490.1 | 68408.m03630 RNA helicase, putative | 1 | 1 |
| 7 | At1g48400.1 | 68408.m04954 F-box protein family | 2 | 1 |
| 8 | At1g64610.1 | 68408.m06712 expressed protein | 2 | 1 |
| 9 | At1g64880.1 | 68408.m06741 ribosomal protein S5 family | 2 | 1 |
| 10 | At1g66620.1 | 68408.m06944 seven in absentia (sina) protein, putative | 2 | 1 |
| 11 | At1g73850.1 | 68408.m07847 expressed protein | 2 | 1 |
| 12 | At2g02270.1 | 68409.m00144 F-box protein (SKP1 interacting partner 3-related) | 2 | 1 |
| 13 | At2g03470.1 | 68409.m00272 MYB family transcription factor -related | 2 | 1 |
| 14 | At2g24550.1 | 68409.m02655 expressed protein | 2 | 1 |
| 15 | At2g33350.1 | 68409.m03697 hypothetical protein | 2 | 1 |
| 16 | At2g33400.1 | 68409.m03703 expressed protein | 2 | 1 |
| 17 | At2g34970.1 | 68409.m03878 translation initiation factor family | 2 | 1 |
| 18 | At2g35340.1 | 68409.m03918 RNA helicase, putative | 2 | 1 |
| 19 | At2g39795.1 | 68409.m04428 expressed protein | 2 | 1 |
| 20 | At2g41690.1 | 68409.m04660 heat shock transcription factor family | 2 | 1 |
| 21 | At3g01080.1 | 68410.m00009 WRKY family transcription factor | 2 | 1 |
| 22 | At3g01160.1 | 68410.m00018 expressed protein | 2 | 1 |
| 23 | At3g12270.1 | 68410.m01372 protein arginine N-methyltransferase family | 2 | 1 |
| 24 | At3g13080.1 | 68410.m06780 ABC transporter family protein | 2 | 1 |
| 25 | At3g13080.2 | 68410.m06781 ABC transporter family protein | 2 | 1 |
| 26 | At3g14970.1 | 68410.m01699 zinc finger (C3HC4-type RING finger) protein family | 2 | 1 |
| 27 | At3g18390.1 | 68410.m02110 expressed protein | 2 | 1 |
| 28 | At3g19880.1 | 68410.m02276 hypothetical protein | 2 | 1 |
| 29 | At3g23160.1 | 68410.m02655 hypothetical protein | 2 | 1 |
| 30 | At3g24780.1 | 68410.m02842 hypothetical protein | 2 | 1 |
| 31 | At3g25910.1 | 68410.m02957 expressed protein | 2 | 1 |
| 32 | At3g28850.1 | 68410.m03305 expressed protein | 2 | 1 |
| 33 | At3g42190.1 | 68410.m04019 hypothetical protein | 2 | 1 |
| 34 | At3g42670.1 | 68410.m04115 SNF2domain/helicase domain-containing protein | 2 | 1 |
| 35 | At3g44110.1 | 68410.m04379 DnaJ protein AtJ3 | 2 | 1 |
| 36 | At3g44110.2 | 68410.m04380 DnaJ protein AtJ3 | 2 | 1 |
| 37 | At3g48860.1 | 68410.m04939 expressed protein | 2 | 1 |
| 38 | At3g48860.2 | 68410.m04940 expressed protein | 2 | 1 |
| 39 | At3g53110.1 | 68410.m05420 DEAD/DEAH box helicase, putative | 2 | 1 |
| 40 | At3g53310.1 | 68410.m05444 transcriptional factor B3 family | 1 | 1 |
| 41 | At3g58440.1 | 68410.m06022 hypothetical protein | 2 | 1 |
| 42 | At3g62590.1 | 68410.m06497 lipase (class 3) family | 2 | 1 |
| 43 | At4g03070.1 | 68411.m00376 2-oxoglutarate-dependent dioxygenase (AOP1.2) | 2 | 1 |
| 44 | At4g03820.1 | 68411.m00480 expressed protein | 2 | 1 |
| 45 | At4g05410.1 | 68411.m00722 transducin / WD-40 repeat protein family | 2 | 1 |
| 46 | At4g17940.1 | 68411.m02436 expressed protein | 2 | 1 |
| 47 | At4g27500.1 | 68411.m03597 proton pump interactor | 1 | 1 |
| 48 | At4g30720.1 | 68411.m03976 expressed protein | 2 | 1 |
| 49 | At4g31620.1 | 68411.m04091 transcriptional factor B3 family | 2 | 1 |
| 50 | At4g34100.1 | 68411.m04400 zinc finger (C3HC4-type RING finger) protein family | 2 | 1 |
| 51 | At5g01380.1 | 68412.m00046 transcription factor GT-3a | 2 | 1 |
| 52 | At5g02050.1 | 68412.m00116 expressed protein | 1 | 1 |
| 53 | At5g04980.1 | 68412.m00488 endonuclease/exonuclease/phosphatase family | 2 | 1 |
| 54 | At5g08139.1 | 68412.m00883 zinc finger (C3HC4-type RING finger) protein family | 2 | 1 |
| 55 | At5g08150.1 | 68412.m00885 hypothetical protein | 2 | 1 |
| 56 | At5g10950.1 | 68412.m01175 expressed protein | 2 | 1 |
| 57 | At5g15140.1 | 68412.m01639 aldose 1-epimerase family | 2 | 1 |
| 58 | At5g18520.1 | 68412.m02010 expressed protein | 2 | 1 |
| 59 | At5g19090.1 | 68412.m07832 heavy-metal-associated domain-containing protein | 2 | 1 |
| 60 | At5g19090.2 | 68412.m07833 heavy-metal-associated domain-containing protein | 2 | 1 |
| 61 | At5g22100.1 | 68412.m02358 Probable RNA 3'-terminal phosphate cyclase-related protein. | 2 | 1 |
| 62 | At5g23950.1 | 68412.m02575 C2 domain-containing protein | 2 | 1 |
| 63 | At5g28080.1 | 68412.m03086 protein kinase family | 2 | 1 |
| 64 | At5g36990.1 | 68412.m03981 transposase -related | 2 | 1 |
| 65 | At5g37560.1 | 68412.m04058 hypothetical protein | 2 | 1 |
| 66 | At5g40340.1 | 68412.m04405 PWWP domain protein | 2 | 1 |
| 67 | At5g41630.1 | 68412.m04562 F-box protein family | 2 | 1 |
| 68 | At5g44290.1 | 68412.m04887 cyclin-dependent protein kinase-related protein | 2 | 1 |
| 69 | At5g48350.1 | 68412.m05386 hypothetical protein | 2 | 1 |
| 70 | At5g55300.1 | 68412.m06236 DNA topoisomerase I (sp P30181) | 2 | 1 |
| 71 | At5g59000.1 | 68412.m06688 zinc finger (C3HC4-type RING finger) protein family | 0 | 1 |
| 72 | At5g60130.1 | 68412.m06824 transcriptional factor B3 family | 2 | 1 |
| 73 | At5g63740.1 | 68412.m07237 hypothetical protein | 1 | 1 |
| 74 | At5g63850.1 | 68412.m07251 amino acid transporter 4 (AAP4) | 2 | 1 |
| 75 | At5g64830.1 | 68412.m07376 expressed protein | 2 | 1 |
| 76 | At5g66540.1 | 68412.m07589 expressed protein | 2 | 1 |
Rice homologs
- gnl|BL_ORD_ID|3151_92593+92790_1-21
- gnl|BL_ORD_ID|1809_5758+5955_1-21