IGR sequence: | igr2848#chr4#x1=14039889#l=4299 |
---|---|
Mature miRNA sequence: | UGACAGAAGAGAGUGAGCACA |
encoded miRNA: | MIR85 |
Precursor location: | 57 - 136 (positive strand) |
precursor length: | 80 (31 basepairs) |
MIR position: | 1 - 21 (57 - 77) |
MIR length: | 21 (19 paired bases) |
miRNA location TIGR v3: | chr4:14039945>14040024 |
miRNA location TIGR v5: | chr4:15074951>15075030 |
Folding energy: | -44.40 |
BLAST hit against RFAM Atha miRNAs: | ath-MIR156b |
Belongs to miRNAs-targets cluster: | cluster019 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** * UGACAGAAGA GAGUGAGCAC AUGCAGGCAC UGUUAUGUGU CUAUAACUUU GCGUGUGCGU 60 :((((((((( (((((((((( --(((-(((- -((((((___ _))))))--) ))-)))--)) GCUCACCUCU CUUUCUGUCA 80 )))))-)))) )-))))))):

Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g27360.1 | 68408.m03023 squamosa-promoter binding protein 2 -related | 2 | 6 |
2 | At1g27370.1 | 68408.m03024 squamosa-promoter binding protein 2 -related | 2 | 6 |
3 | At1g53160.1 | 68408.m05523 transcription factor -related | 2 | 8 |
4 | At1g69170.1 | 68408.m07265 squamosa-promoter binding protein -related | 2 | 6 |
5 | At2g33810.1 | 68409.m03749 squamosa-promoter binding protein -related | 2 | 4 |
6 | At2g42200.1 | 68409.m05466 squamosa-promoter binding protein -related | 1 | 8 |
7 | At2g42200.2 | 68409.m05467 squamosa-promoter binding protein -related | 1 | 8 |
8 | At3g57920.1 | 68410.m05967 squamosa promoter-binding protein homolog | 1 | 8 |
9 | At5g43270.1 | 68412.m07892 squamosa promoter binding protein-related 2 (emb|CAB56576.1) | 2 | 5 |
10 | At5g43270.2 | 68412.m07893 squamosa promoter binding protein-related 2 (emb|CAB56576.1) | 2 | 5 |
11 | At5g50570.1 | 68412.m07940 expressed protein | 1 | 8 |
12 | At5g50570.2 | 68412.m07941 expressed protein | 1 | 8 |
13 | At5g50670.1 | 68412.m05668 expressed protein | 1 | 8 |
Rice homologs
- gnl|BL_ORD_ID|2522_50929+51014_1-21
- gnl|BL_ORD_ID|2522_50929-51014_66-86
- gnl|BL_ORD_ID|2458_36067-36155_69-89
- gnl|BL_ORD_ID|2458_36067+36155_1-21
- gnl|BL_ORD_ID|2094_35724+35809_1-21
- gnl|BL_ORD_ID|2094_35724-35809_66-86
- gnl|BL_ORD_ID|2094_35724-35804_61-81
- gnl|BL_ORD_ID|1148_144468-144556_69-89
- gnl|BL_ORD_ID|1148_144468+144556_1-21
- gnl|BL_ORD_ID|640_18783+18868_1-21
- gnl|BL_ORD_ID|640_18783-18868_66-86
- gnl|BL_ORD_ID|342_115900+115983_1-21
- gnl|BL_ORD_ID|342_115900-115983_64-84
- gnl|BL_ORD_ID|342_115900-115978_59-79
- gnl|BL_ORD_ID|62_1184-1269_66-86
- gnl|BL_ORD_ID|62_1184-1264_61-81
- gnl|BL_ORD_ID|62_1184+1269_1-21