IGR sequence: | igr2848#chr4#x1=14039889#l=4299 |
---|---|
Mature miRNA sequence: | CUGACAGAAGAGAGUGAGCACA |
encoded miRNA: | MIR85a |
Precursor location: | 56 - 137 (positive strand) |
precursor length: | 82 (33 basepairs) |
MIR position: | 1 - 22 (56 - 77) |
MIR length: | 22 (21 paired bases) |
miRNA location TIGR v3: | chr4:14039944>14040025 |
miRNA location TIGR v5: | chr4:15074950>15075031 |
Folding energy: | -46.90 |
BLAST hit against RFAM Atha miRNAs: | ath-MIR156b |
Belongs to miRNAs-targets cluster: | cluster019 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ** CUGACAGAAG AGAGUGAGCA CAUGCAGGCA CUGUUAUGUG UCUAUAACUU UGCGUGUGCG 60 (((((((((( (((((((((( (--(((-((( --((((((__ __))))))-- )))-)))--) UGCUCACCUC UCUUUCUGUC AG 82 ))))))-))) ))-))))))) ))

Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g27360.1 | 68408.m03023 squamosa-promoter binding protein 2 -related | 3 | 6 |
2 | At1g27370.1 | 68408.m03024 squamosa-promoter binding protein 2 -related | 3 | 6 |
3 | At1g53160.1 | 68408.m05523 transcription factor -related | 3 | 8 |
4 | At1g69170.1 | 68408.m07265 squamosa-promoter binding protein -related | 2 | 6 |
5 | At2g33810.1 | 68409.m03749 squamosa-promoter binding protein -related | 2 | 4 |
6 | At2g42200.1 | 68409.m05466 squamosa-promoter binding protein -related | 2 | 8 |
7 | At2g42200.2 | 68409.m05467 squamosa-promoter binding protein -related | 2 | 8 |
8 | At3g57920.1 | 68410.m05967 squamosa promoter-binding protein homolog | 2 | 8 |
9 | At5g43270.1 | 68412.m07892 squamosa promoter binding protein-related 2 (emb|CAB56576.1) | 3 | 5 |
10 | At5g43270.2 | 68412.m07893 squamosa promoter binding protein-related 2 (emb|CAB56576.1) | 3 | 5 |
11 | At5g50570.1 | 68412.m07940 expressed protein | 2 | 8 |
12 | At5g50570.2 | 68412.m07941 expressed protein | 2 | 8 |
13 | At5g50670.1 | 68412.m05668 expressed protein | 2 | 8 |
Rice homologs
- gnl|BL_ORD_ID|2024_146530-146641_91-112
- gnl|BL_ORD_ID|2024_146530+146641_1-22
- gnl|BL_ORD_ID|2021_81342+81453_1-22
- gnl|BL_ORD_ID|2021_81342-81453_91-112
- gnl|BL_ORD_ID|490_72598+72685_1-22
- gnl|BL_ORD_ID|490_72598+72681_1-22
- gnl|BL_ORD_ID|490_72598-72685_67-88
- gnl|BL_ORD_ID|490_72598-72687_69-90
- gnl|BL_ORD_ID|490_72218+72310_1-22
- gnl|BL_ORD_ID|490_72218-72310_72-93
- gnl|BL_ORD_ID|490_72218-72313_75-96
- gnl|BL_ORD_ID|457_25627+25714_1-22
- gnl|BL_ORD_ID|457_25627+25710_1-22
- gnl|BL_ORD_ID|457_25627-25714_67-88
- gnl|BL_ORD_ID|457_25627-25716_69-90
- gnl|BL_ORD_ID|457_25247+25339_1-22
- gnl|BL_ORD_ID|457_25247-25339_72-93
- gnl|BL_ORD_ID|457_25247-25342_75-96