IGR sequence: | igr795#chr5#x1=3454190#l=5083 |
---|---|
Mature miRNA sequence: | UGACAGAAGAGAGUGAGCACAC |
encoded miRNA: | MIR17 |
Precursor location: | 2459 - 2544 (negative strand) |
precursor length: | 86 (34 basepairs) |
MIR position: | 1 - 22 (2523 - 2544) |
MIR length: | 22 (20 paired bases) |
miRNA location TIGR v3: | chr5:3456648<3456733 |
miRNA location TIGR v5: | chr5:3456648<3456733 |
Folding energy: | -44.40 |
BLAST hit against RFAM Atha miRNAs: | ath-MIR156d |
Belongs to miRNAs-targets cluster: | cluster019 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ** UGACAGAAGA GAGUGAGCAC ACAAAGGGGA AGUUGUAUAA AAGUUUUGUA UAUGGUUGCU 60 :((((((((( (((((((((( -((((((-(( ---((((((( _____))))) ))---))-)) UUUGCGUGCU CACUCUCUUU UUGUCA 86 ))))-))))) )))))))-)) ))))):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g27360.1 | 68408.m03023 squamosa-promoter binding protein 2 -related | 3 | 6 |
2 | At1g27370.1 | 68408.m03024 squamosa-promoter binding protein 2 -related | 3 | 6 |
3 | At1g53160.1 | 68408.m05523 transcription factor -related | 2 | 8 |
4 | At1g69170.1 | 68408.m07265 squamosa-promoter binding protein -related | 3 | 6 |
5 | At2g33810.1 | 68409.m03749 squamosa-promoter binding protein -related | 3 | 4 |
6 | At2g42200.1 | 68409.m05466 squamosa-promoter binding protein -related | 2 | 8 |
7 | At2g42200.2 | 68409.m05467 squamosa-promoter binding protein -related | 2 | 8 |
8 | At3g57920.1 | 68410.m05967 squamosa promoter-binding protein homolog | 2 | 8 |
9 | At5g43270.1 | 68412.m07892 squamosa promoter binding protein-related 2 (emb|CAB56576.1) | 3 | 5 |
10 | At5g43270.2 | 68412.m07893 squamosa promoter binding protein-related 2 (emb|CAB56576.1) | 3 | 5 |
11 | At5g50570.1 | 68412.m07940 expressed protein | 2 | 8 |
12 | At5g50570.2 | 68412.m07941 expressed protein | 2 | 8 |
13 | At5g50670.1 | 68412.m05668 expressed protein | 2 | 8 |
Rice homologs
- gnl|BL_ORD_ID|2522_50865-50950_1-22
- gnl|BL_ORD_ID|2522_50865+50950_65-86
- gnl|BL_ORD_ID|2458_35999+36087_68-89
- gnl|BL_ORD_ID|2458_35999-36087_1-22
- gnl|BL_ORD_ID|1148_144400+144488_68-89
- gnl|BL_ORD_ID|1148_144400-144488_1-22
- gnl|BL_ORD_ID|640_18719-18804_1-22
- gnl|BL_ORD_ID|640_18719+18804_65-86