PLAZA 3.0 Dicots : Binding Sites

Binding sites with simlar sequences

Binding site: Motif_14
Name: EIN3ATERF1
Description: EIN3 (Ethylene-insensitive 3) binding site found in the promoter of the Arabidopsis (A.t.) ERF1 (Ethylene-Response-Factor 1); EIN3 recognizes its target as a homodimer; EIN3 is necessary and sufficient for ERF1 expression; Consititutive expression of ERF1 results in the activation of a variety of ethylene response genes and phenotype; ERF1 is a GCC-box binding site; ERF1 acts downstream of EIN3

Sequence: GGATTCAAGGGGCATGTATCTTGAATCC
Positional Weight Matrix

Minimum similarity percentage

Binding site	Name	Description	Similarity
Motif_529	EIN3 BS in ERF1	Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1	96.43%
Motif_359	EIL3 BS in ERF1; EIL1 BS in ERF1; EIL2 BS in ERF1	Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1	75.00%
Motif_77	IDE1HVIDS2	IDE1 (iron-deficiency-responsive element 1) found at -153/-136 of barley IDS2 (iron deficiency specific clone 2) gene promoter	57.14%
Motif_340	SE2PVGRP1	SE2 (stem element 2) of bean GRP1.8 gene; part of SE2 element	54.15%
Motif_302	OCSGMHSP26A	Ocs element found in soybean (Glycine max) heat shock gene (Gmhsp26-A) promoter; The element is a functional ocs-element; The element did not affect the promoter's response to heat or wounding	53.57%
Motif_466	-141NTG13	-141 sequence; Binding site of tobacco TGA1a-related protein,PG13, found in the G13 gene promoter; PG13 (Protein encoded by G13) shows high homology to TGA1a; ASF-1, PG13, and TGA1a bind to the same target sequence in the 5' upstream region of G13	50.00%
Motif_548	SARECAMV	Salicylic acid responsive element found in CaMV 35S promoter; Identical to as-1; Binding with ASF-1 (Activation Sequence Factor-1); See AS1	50.00%
Motif_103	OCSGMGH24	OCS element found in the soybean GH2/4 gene promoter; Required for auxin and salycylic acid responsiveness; Activated by both active and inactive auxin and salicylic acid analogues; Tandem OCSTF binding-sites are essential for the activity of the Ocs-element; The Ocs-element occurs rarely in plant gene promoters	50.00%