PLAZA 3.0 Dicots : Binding Sites

Binding site page : Motif_466

Identifier: Motif_466
Name: -141NTG13
Description: -141 sequence; Binding site of tobacco TGA1a-related protein,PG13, found in the G13 gene promoter; PG13 (Protein encoded by G13) shows high homology to TGA1a; ASF-1, PG13, and TGA1a bind to the same target sequence in the 5' upstream region of G13

Number of genes: 0
Sequence: GCTTTTGATGACTTCAAACAC
Positional Weight Matrix

Binding site distribution per species

Binding site distribition per location

Toolbox

Explore

... associated Gene Ontology annotation of this binding site.
... associated InterPro annotation of this binding site.
... associated MapMan annotation of this binding site.

View

... the associated gene families.
... the binding sites with a similar sequence.

Gene List

Index of genes with 1 constraints:

Binding site : Motif_466

There are no genes matching these requirements !