Binding site page : Motif_359
- Identifier
- Motif_359
- Name
- EIL3 BS in ERF1;EIL1 BS in ERF1;EIL2 BS in ERF1
- Description
- Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1
- Number of genes
- 0
- Sequence
- TTCAAGGGGGCATGTATCTTGAA
- Positional Weight Matrix
Binding site distribution per species
Binding site distribition per location
Toolbox
Explore
- ... associated Gene Ontology annotation of this binding site.
- ... associated InterPro annotation of this binding site.
- ... associated MapMan annotation of this binding site.
View
- ... the associated gene families.
- ... the binding sites with a similar sequence.
Associated Transcription Factors
Transcription factor | Alias | Description | Orthologs | Associated motifs |
---|---|---|---|---|
AT2G27050 | ETHYLENE-INSENSITIVE3-like 1 | Q9SLH0;EIL1 | View orthologs | View associated binding sites |
AT5G21120 | ETHYLENE-INSENSITIVE3-like 2 | O23115;EIL2 | View orthologs | View associated binding sites |
AT1G73730 | ETHYLENE-INSENSITIVE3-like 3 | O23116;ATSLIM | View orthologs | View associated binding sites |
Gene List
Index of genes with 1 constraints:
- Binding site : Motif_359
There are no genes matching these requirements !