Binding site page : Motif_14
- Identifier
- Motif_14
- Name
- EIN3ATERF1
- Description
- EIN3 (Ethylene-insensitive 3) binding site found in the promoter of the Arabidopsis (A.t.) ERF1 (Ethylene-Response-Factor 1); EIN3 recognizes its target as a homodimer; EIN3 is necessary and sufficient for ERF1 expression; Consititutive expression of ERF1 results in the activation of a variety of ethylene response genes and phenotype; ERF1 is a GCC-box binding site; ERF1 acts downstream of EIN3
- Number of genes
- 0
- Sequence
- GGATTCAAGGGGCATGTATCTTGAATCC
- Positional Weight Matrix
Binding site distribution per species
Binding site distribition per location
Toolbox
Explore
- ... associated Gene Ontology annotation of this binding site.
- ... associated InterPro annotation of this binding site.
- ... associated MapMan annotation of this binding site.
View
- ... the associated gene families.
- ... the binding sites with a similar sequence.
Gene List
Index of genes with 1 constraints:
- Binding site : Motif_14
There are no genes matching these requirements !