Binding site page : Motif_302
- Identifier
- Motif_302
- Name
- OCSGMHSP26A
- Description
- Ocs element found in soybean (Glycine max) heat shock gene (Gmhsp26-A) promoter; The element is a functional ocs-element; The element did not affect the promoter's response to heat or wounding
- Number of genes
- 0
- Sequence
- TGATGTAAGAGATTACGTAA
- Positional Weight Matrix
Binding site distribution per species
Binding site distribition per location
Toolbox
Explore
- ... associated Gene Ontology annotation of this binding site.
- ... associated InterPro annotation of this binding site.
- ... associated MapMan annotation of this binding site.
View
- ... the associated gene families.
- ... the binding sites with a similar sequence.
Gene List
Index of genes with 1 constraints:
- Binding site : Motif_302
There are no genes matching these requirements !