Binding site page : Motif_529
- Identifier
- Motif_529
- Name
- EIN3 BS in ERF1
- Description
- Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1
- Number of genes
- 0
- Sequence
- GGATTCAAGGGGGCATGTATCTTGAATCC
- Positional Weight Matrix
Binding site distribution per species
Binding site distribition per location
Toolbox
Explore
- ... associated Gene Ontology annotation of this binding site.
- ... associated InterPro annotation of this binding site.
- ... associated MapMan annotation of this binding site.
View
- ... the associated gene families.
- ... the binding sites with a similar sequence.
Associated Transcription Factors
Transcription factor | Alias | Description | Orthologs | Associated motifs |
---|---|---|---|---|
AT3G20770 | Ethylene insensitive 3 family protein | ETHYLENE-INSENSITIVE3;O24606 | View orthologs | View associated binding sites |
Gene List
Index of genes with 1 constraints:
- Binding site : Motif_529
There are no genes matching these requirements !