Binding site page : Motif_103
- Identifier
- Motif_103
- Name
- OCSGMGH24
- Description
- OCS element found in the soybean GH2/4 gene promoter; Required for auxin and salycylic acid responsiveness; Activated by both active and inactive auxin and salicylic acid analogues; Tandem OCSTF binding-sites are essential for the activity of the Ocs-element; The Ocs-element occurs rarely in plant gene promoters
- Number of genes
- 0
- Sequence
- CGGTTTACGTAATCTCTTACATCA
- Positional Weight Matrix
Binding site distribution per species
Binding site distribition per location
Toolbox
Explore
- ... associated Gene Ontology annotation of this binding site.
- ... associated InterPro annotation of this binding site.
- ... associated MapMan annotation of this binding site.
View
- ... the associated gene families.
- ... the binding sites with a similar sequence.
Gene List
Index of genes with 1 constraints:
- Binding site : Motif_103
There are no genes matching these requirements !