PLAZA 3.0 Dicots : Binding Sites

Binding sites with simlar sequences

Binding site: Motif_605
Name: 20NTNTNOS
Description: 20nt (20 nucleotide sequence) found in the promoter on tobacco nopalin synthase (nos) gene promoter; Containing two hexamer motifs (TGAGCT) and a spacer region; The spacer region between two hexamer motifs is essential; Important for the gene expression; Essential for response to wounding, auxin, MJ, and SA; Very similar to ASF-1 binding site

Sequence: TGAGCTAAGCACATACGTCA
Positional Weight Matrix

Minimum similarity percentage

Binding site	Name	Description	Similarity
Motif_678	ASF1ATNOS	Tobacco ASF-1 binding site in nopaline synthase (NOS) promoter of Ti-plasmid of Agrobacterium tumefaciens; From -131 to -111; Containing two hexamer motifs; Essential for the nos promoter activity	95.00%
Motif_302	OCSGMHSP26A	Ocs element found in soybean (Glycine max) heat shock gene (Gmhsp26-A) promoter; The element is a functional ocs-element; The element did not affect the promoter's response to heat or wounding	70.00%
Motif_360	OCS promoter motif	The ocs-element is a component of the promoters of several T-DNA and plant viral genes	67.50%
Motif_280	OCSELEMENTAT	OCS element in octopine synthase gene (OCS) of Ti-plasmid of Agrobacterium; Binding with nuclear protein isolated from tobacco; See OCS motif; ocs-like element; Also found in Arabidopsis glutathione S-transferase gene (GST6); OBF (ocs element binding factor)-binding site; See S000346; Tandem OCSTF binding-sites are essential for the activity of the Ocs-element; The Ocs-element occures rarely in plant gene promoters	65.00%
Motif_679	SB1NPABC1	Sclareol box1 (SB1) found at -827 of a plasma membrane ATP binding cassette (ABC) transporter gene (NpABC1) in N. plumbaginifolia; Mutation in SB3 completely abolished sclareolide-mediated expression	65.00%
Motif_81	ALF1NTPARC	ALF-1 (as-1-like sequence binding factor) binding site found in tobacco parC gene; Found in auxin-responsive regions; as-1-like sequences in parA, parB and parC bind with ASF-1, ALF-2, and ALF-1, respectively; See ABFOS	65.00%
Motif_68	PASNTPARA	pas; as-1-related element found in the tobacco parA gene promoter; Involved in Cadmium responsiveness; Not related to copper responsiveness; Located between -68 and -49	65.00%
Motif_35	ASF1NTPARA	ASF-1 (as-1 binding nuclear factor) binding site found in tobacco parA gene; Found in auxin-responsive regions; as-1-like sequences in parA, parB and parC bind with ASF-1, ALF-2, and ALF-1, respectively; See ABFOS,ALF1NTPARC,ALF2NTPARB	60.00%
Motif_149	OCSENHANMOTIFAT	OCS enhancer element in octopine synthase gene (OCS) of Ti-plasmid of Agrobacterium tumefaciens; Binding with nuclear protein isolated from tobacco and maize; Tandem OCSTF binding-sites are essential for the activity of the Ocs-element; The Ocs-element occures rarely in plant gene promoters; OCS palindrome found in tobacco OCS (Octopine synthase gene) promoter; Located at -193 to -178; Binding site of ASF-1; Confers expression of the gene	60.00%
Motif_550	MRE motif in CHS	MREAtCHS (MRE = Myb Recognition Element) found in the LRU (light-responsive unit) in Arabidopsis chalcone synthase (CHS) gene promoter; Required for UV-B and UV-A/blue light responsiveness;Identification of UV/blue light-response elements in the Arabidopsis thaliana chalcone synthase promoter using a homologous protoplast transient expression system	60.00%
Motif_333	GLUTEBP1OS	Glutelin BP-1; Binding site in the promoter region of glutelin Gt3 gene family of nuclear factor (PB-1); PB-1 is observed only in nuclear extract of developing seeds	55.00%
Motif_583	AtbZIP1	The arabidopsis bZIP1 transcription factor is involved in sugar signaling, protein networking, and DNA binding	55.00%
Motif_664	C1GMAUX28	C1; DNase I protected sequence found in the soybean auxin responsive gene, Aux28, promoter; Located between -463 and -448; A/T-rich sequence	55.00%
Motif_548	SARECAMV	Salicylic acid responsive element found in CaMV 35S promoter; Identical to as-1; Binding with ASF-1 (Activation Sequence Factor-1); See AS1	55.00%
Motif_398	GLUTEBOX1OSGT3	Box 1 of rice glutelin Gt3 gene family promoter region; See S000128 GLUTEBOX2A	55.00%
Motif_553	BOX2PSGS2	Box 2 in glutamine synthetase (GS2) gene in pea; Repeated in tandem with a partial palindrome located between the repeats; Located at ca. -300 of pea GS2	55.00%
Motif_474	ELRENTCHN50	Elicitor-responsive element (ElRE); Found in tobacco basic class I chitinase gene (CHN50)	50.81%
Motif_331	AtWER	Regulation of CAPRICE transcription by MYB proteins for root epidermis differentiation in Arabidopsis	50.00%
Motif_569	TACBBFNTEAS4	TacBBF (TAC box binding factor) binding site in tobacco 5-epi-aristolochene synthase (EAS4) gene; Required for elicitor-inducibility; EAS is involved in sesquiterpene phytoalexin biosynthesis; Found between -245 and -232; Appears to function as a silencer or repressor of EAS gene expression	50.00%
Motif_328	GLUTEBP2OS	Glutelin BP-2; Binding with nuclear factors from developing seeds	50.00%
Motif_208	MYB80	The MYB80 transcription factor is required for pollen development and the regulation of tapetal programmed cell death in Arabidopsis thaliana	50.00%
Motif_441	GAGA8HVBKN3	GA octodinucleotide repeat found in intron IV of the barley gene Bkn3; Binding site for GAGA-binding factor BBR	50.00%
Motif_387	AG BS in SPL/NOZ	The homeotic protein AGAMOUS controls microsporogenesis by regulation of SPOROCYTELESS	50.00%
Motif_225	PRHA BS in PAL1; PRHA BS in PAL1	Developmental and auxin-induced expression of the Arabidopsis prha homeobox gene	50.00%
Motif_238	AtWER	Regulation of CAPRICE transcription by MYB proteins for root epidermis differentiation in Arabidopsis	50.00%
Motif_578	BBOXSITE1STPAT	10 base pair motif (site 1) within the B-box found in the potato patatin gene promoter; Involved in potato tuber-specific and sucrose-inducible gene expression; Storekeeper (STK) binds to this region and regulates patatin expression in potato	50.00%
Motif_283	TRANSTART	plant consensus sequence for translation start site	50.00%
Motif_314	HY5AT	G box; Binding site of Arabidopsis bZIP protein HY5; HY5 is constitutively nuclear localized and is involved in light regulation of transcriptional activity of the promoters containing the G-box;HY5 abundance peaks in early seedling development, consistent with its role in promoting photomorphogenesis; HY5 stability and activity is regulated by phosphorylation in its COP1 binding domain; HY5 regulates stimulus-induced development of root and hypocotyl	50.00%
Motif_546	AtWER	Regulation of CAPRICE transcription by MYB proteins for root epidermis differentiation in Arabidopsis	50.00%
Motif_129	GAGAGMGSA1	GAGA element found in the promoter of the heme and chlorophyll synthesis gene Gsa1 in soybean; GAGA binding protein (GBP) binds to (GA)n/(CT)n DNA	50.00%
Motif_501	ELRE2PCPAL1	One of two elicitor (ELRE) and light response elements (LRE) found in the parsley (P.c.) phenylalanine ammonia-lyase (PAL-1) gene promoter; Involved in UV light and elicitor responsiveness; Conserved in several elicitor or light-responsive genes	50.00%
Motif_417	SITE1SORPS1	Site 1 in the spinach rps1 promoter; S1F binding site; Nuclear genes encoding plastid ribosomal proteins are more highly expressed in leaves than in root; Involved in leaf-specific induction; Seems to be light-independent; Involved in negative regulation; Related to the light-responsive Box II of the pea rbcs-3A promoter; Related to GT elements; S1 box=ATGGTA	50.00%
Motif_540	CCA1 motif1 BS in CAB1	A myb-related transcription factor is involved in the phytochrome regulation of an Arabidopsis Lhcb gene	50.00%
Motif_11	L4DCPAL1	L4 element, found in PAL1 promoter in carrot (Daucus carota), is a UV-B responsive element; L4 contains Box L-like sequence (TCCAACCA)	50.00%
Motif_160	GAREHVAMY1	GARE (gibberellic acid responsive element) of barley alpha-amylase gene (Amy 1/6-4); GA3	50.00%
Motif_23	14BPATERD1	14 bp region (from -599 to -566) necessary for expression of erd1 (early responsive to dehydration) in dehydrated Arabidopsis	50.00%
Motif_646	AACAOSGLUB1	AACA motif found in GluB-1 gene in rice; Required for endosperm-specific expression; Highly conserved in the 5'-flanking region of glutelin genes	50.00%
Motif_396	ANAEROBICCISZMGAPC4	20 bp anaerobic cis-regulatory sequence found in the maize GapC4 (Glyceraldehyde-3-phosphate dehydrogenase 4) gene promoter; Located between -286 and -266; Required for anaerobic gene expression in transgenic tobacco	50.00%
Motif_481	GLUTEBOX1OSGT2	Box 1 of rice glutelin Gt2 gene family promoter regions; nuclear factor binding site	50.00%