Binding site page : Motif_396
- Identifier
- Motif_396
- Name
- ANAEROBICCISZMGAPC4
- Description
- 20 bp anaerobic cis-regulatory sequence found in the maize GapC4 (Glyceraldehyde-3-phosphate dehydrogenase 4) gene promoter; Located between -286 and -266; Required for anaerobic gene expression in transgenic tobacco
- Number of genes
- 0
- Sequence
- CGAAACCAGCAACGGTCCAG
- Positional Weight Matrix
Binding site distribution per species
Binding site distribition per location
Toolbox
Explore
- ... associated Gene Ontology annotation of this binding site.
- ... associated InterPro annotation of this binding site.
- ... associated MapMan annotation of this binding site.
View
- ... the associated gene families.
- ... the binding sites with a similar sequence.
Gene List
Index of genes with 1 constraints:
- Binding site : Motif_396
There are no genes matching these requirements !