Binding site page : Motif_605
- Identifier
- Motif_605
- Name
- 20NTNTNOS
- Description
- 20nt (20 nucleotide sequence) found in the promoter on tobacco nopalin synthase (nos) gene promoter; Containing two hexamer motifs (TGAGCT) and a spacer region; The spacer region between two hexamer motifs is essential; Important for the gene expression; Essential for response to wounding, auxin, MJ, and SA; Very similar to ASF-1 binding site
- Number of genes
- 0
- Sequence
- TGAGCTAAGCACATACGTCA
- Positional Weight Matrix
Binding site distribution per species
Binding site distribition per location
Toolbox
Explore
- ... associated Gene Ontology annotation of this binding site.
- ... associated InterPro annotation of this binding site.
- ... associated MapMan annotation of this binding site.
View
- ... the associated gene families.
- ... the binding sites with a similar sequence.
Gene List
Index of genes with 1 constraints:
- Binding site : Motif_605
There are no genes matching these requirements !