PLAZA 3.0 Dicots : Binding Sites

Binding sites with simlar sequences

Binding site: Motif_538
Name: LFY BS in AP3
Description: Not Available

Sequence: CTTAAACCCTAGGGGTAAAT
Positional Weight Matrix

Minimum similarity percentage

Binding site	Name	Description	Similarity
Motif_434	LFY BS in AP3	Regulation of APETALA3 floral homeotic gene expression by meristem identity genes	95.00%
Motif_458	ELEMENT2GMLBC3	Element 2 found in the promoter of soybean leghaemoglobin lbc3 gene; Binding site of nuclear extract from soybean nodules; Located at -161 to -176; Element 1 and Element 2 bind to the same nodule specific factor; Element 2 is highly conserved in other soybean lb gene promoter regions	55.00%
Motif_397	LFY	Structural basis for LEAFY floral switch function and similarity with helix-turn-helix proteins	55.00%
Motif_6	AGL1 binding site motif	Binding consensus sequence of Arabidopsis AGL1 (AGAMOUS-like 1); AGL1 contains MADS domain; AGL20 is a MADS domain gene from Arabidopsis that is activated in shoot apical meristem during the transition to flowering; AGL20 is also regulated by the Gibberellin pathway; Complex regulatory net works involving several MADS-genes underlie development of vegetative structures	53.71%
Motif_504	LFY	Structural basis for LEAFY floral switch function and similarity with helix-turn-helix proteins	52.44%
Matrix_445	AG	Not Available	50.50%
Matrix_98	AG	Isolation and characterization of the binding sequences for the product of the Arabidopsis floral homeotic gene AGAMOUS	50.50%
Matrix_43	AG	Not Available	50.50%
Motif_45	AGL25; SOC1	FLOWERING LOCUS C (FLC) regulates development pathways throughout the life cycle of Arabidopsis;Genome-wide identification of SOC1 and SVP targets during the floral transition in Arabidopsis	50.00%
Motif_44	AGL25	FLOWERING LOCUS C (FLC) regulates development pathways throughout the life cycle of Arabidopsis	50.00%
Motif_613	SB3NPABC1	Sclareol box3 (SB3) found at -216 of a plasma membrane ATP binding cassette (ABC) transporter gene (NpABC1) in N. plumbaginifolia; Mutation in SB3 completely abolished sclareolide-mediated expression	50.00%
Motif_396	ANAEROBICCISZMGAPC4	20 bp anaerobic cis-regulatory sequence found in the maize GapC4 (Glyceraldehyde-3-phosphate dehydrogenase 4) gene promoter; Located between -286 and -266; Required for anaerobic gene expression in transgenic tobacco	50.00%
Motif_35	ASF1NTPARA	ASF-1 (as-1 binding nuclear factor) binding site found in tobacco parA gene; Found in auxin-responsive regions; as-1-like sequences in parA, parB and parC bind with ASF-1, ALF-2, and ALF-1, respectively; See ABFOS,ALF1NTPARC,ALF2NTPARB	50.00%
Motif_229	D2GMAUX28	D2; DNase I protected sequence found in the soybean auxin responsive gene, Aux28, promoter; Located between -703 and -716; A/T-rich sequence	50.00%
Motif_449	AGL25; SVP	FLOWERING LOCUS C (FLC) regulates development pathways throughout the life cycle of Arabidopsis. Genome-wide identification of SOC1 and SVP targets during the floral transition in Arabidopsis	50.00%
Motif_185	CArG2 motif in AP3	CArG2 found in the Arabidopsis APETALA3 (AP3) gene promoter; Mutations in CArG2 result in a decrease in the expression in petals, but the expression pattern in stamens is unchanged; The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects	50.00%
Motif_111	CArG1 motif in AP3	CArG1 found in the Arabidopsis APETALA3 (AP3) gene promoter; Binding site of AP3/PI heterodimer; Binding site of AP3/PI heterodimer; Binding site for a positively acting factors; MADS domain transcription factors bind with a consensus sequence called the CArG box; The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects	50.00%
Motif_387	AG BS in SPL/NOZ	The homeotic protein AGAMOUS controls microsporogenesis by regulation of SPOROCYTELESS	50.00%
Motif_679	SB1NPABC1	Sclareol box1 (SB1) found at -827 of a plasma membrane ATP binding cassette (ABC) transporter gene (NpABC1) in N. plumbaginifolia; Mutation in SB3 completely abolished sclareolide-mediated expression	50.00%
Motif_114	RSRBNEXTA	RSR (root specific region) in promoter region of Brassica napus extA extensin gene	50.00%
Motif_664	C1GMAUX28	C1; DNase I protected sequence found in the soybean auxin responsive gene, Aux28, promoter; Located between -463 and -448; A/T-rich sequence	50.00%
Motif_206	ARELIKEGHPGDFR2	Sequence highly similar to ARE (anthocyanin regulatory element) found in maize anthocyanin promoter; Binding site of R2R3-type MYB factor, GMYB 10 of G. hybrida	50.00%
Motif_316	23BPUASNSCYCB1	23 bp UAS (Upstream activating sequence) found in the promoter of Nicotiana sylvestris CycB1 gene; Located between -386 and -409; Contains a 5 bp element identical to the MYB binding core (ACGT); Required for M-phase-specific expression; Binds protein complexes in a cell cycle-regulated manner	50.00%