Binding site page : Motif_316
- Identifier
- Motif_316
- Name
- 23BPUASNSCYCB1
- Description
- 23 bp UAS (Upstream activating sequence) found in the promoter of Nicotiana sylvestris CycB1 gene; Located between -386 and -409; Contains a 5 bp element identical to the MYB binding core (ACGT); Required for M-phase-specific expression; Binds protein complexes in a cell cycle-regulated manner
- Number of genes
- 0
- Sequence
- TTTATTTACCAAACGGTAACATC
- Positional Weight Matrix
Binding site distribution per species
Binding site distribition per location
Toolbox
Explore
- ... associated Gene Ontology annotation of this binding site.
- ... associated InterPro annotation of this binding site.
- ... associated MapMan annotation of this binding site.
View
- ... the associated gene families.
- ... the binding sites with a similar sequence.
Gene List
Index of genes with 1 constraints:
- Binding site : Motif_316
There are no genes matching these requirements !