Binding site page : Motif_538
- Identifier
- Motif_538
- Name
- LFY BS in AP3
- Description
- Not available
- Number of genes
- 0
- Sequence
- CTTAAACCCTAGGGGTAAAT
- Positional Weight Matrix
Binding site distribution per species
Binding site distribition per location
Toolbox
Explore
- ... associated Gene Ontology annotation of this binding site.
- ... associated InterPro annotation of this binding site.
- ... associated MapMan annotation of this binding site.
View
- ... the associated gene families.
- ... the binding sites with a similar sequence.
Associated Transcription Factors
Transcription factor | Alias | Description | Orthologs | Associated motifs |
---|---|---|---|---|
AT5G61850 | floral meristem identity control protein LEAFY (LFY) | LEAFY;Q00958 | View orthologs | View associated binding sites |
Gene List
Index of genes with 1 constraints:
- Binding site : Motif_538
There are no genes matching these requirements !