IGR sequence: | igr2011#chr4#x1=10447721#l=2403 |
---|---|
Mature miRNA sequence: | AGCCAAGGAUGACUUGCCGG |
encoded miRNA: | MIR77 |
Precursor location: | 320 - 398 (negative strand) |
precursor length: | 79 (30 basepairs) |
MIR position: | 1 - 20 (379 - 398) |
MIR length: | 20 (19 paired bases) |
miRNA location TIGR v3: | chr4:10448040<10448118 |
miRNA location TIGR v5: | chr4:11483046<11483124 |
Folding energy: | -40.10 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster006 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** AGCCAAGGAU GACUUGCCGG GUUUUUUUAC CAAUGAAUCU AAUUAACUGA UUCUGGUGUC 60 ((((((((-( (((((((((( (------((( ((--(((((_ ________)) )))))))))) CGGCAAGUUG ACCUUGGCU 79 )))))))))) -))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g54160.1 | 68408.m05664 CCAAT-binding factor B subunit -related | 2 | 8 |
2 | At5g12840.1 | 68412.m08219 CCAAT box binding factor/ transcription factor Hap2a | 2 | 2 |
3 | At5g12840.2 | 68412.m08220 CCAAT box binding factor/ transcription factor Hap2a | 2 | 2 |
Rice homologs
- gnl|BL_ORD_ID|3091_167854+167959_87-106
- gnl|BL_ORD_ID|3091_167854-167959_1-20
- gnl|BL_ORD_ID|2404_2611-2700_1-20
- gnl|BL_ORD_ID|2404_2611+2700_71-90
- gnl|BL_ORD_ID|2314_13778+13867_71-90
- gnl|BL_ORD_ID|2314_13778-13867_1-20
- gnl|BL_ORD_ID|1188_62445+62548_85-104
- gnl|BL_ORD_ID|1181_130578-130683_1-20
- gnl|BL_ORD_ID|1181_130578+130683_87-106