IGR sequence: | igr961#chr1#x1=3960414#l=2862 |
---|---|
Mature miRNA sequence: | GAUUGAGCCGUGCCAAUAUC |
encoded miRNA: | MIR58c |
Precursor location: | 957 - 1036 (negative strand) |
precursor length: | 80 (30 basepairs) |
MIR position: | 61 - 80 (957 - 976) |
MIR length: | 20 (17 paired bases) |
miRNA location TIGR v3: | chr1:3961370<3961449 |
miRNA location TIGR v5: | chr1:3961370<3961449 |
Folding energy: | -34.10 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster023 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
GAUAUUAGUG CGGUUCAAUC AAAUAGUCGU CCUCUUAACU CAUGGAGAAC GGUGUUGUUC 60 ((((((-(-- (((((((((( -((((((((( -((((_____ ___))))-)) ))--)))))- ********** ********** GAUUGAGCCG UGCCAAUAUC 80 )))))))))) --)-))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At2g45160.1 | 68409.m05078 scarecrow transcription factor family | 1 | 7 |
2 | At3g60630.1 | 68410.m06267 scarecrow transcription factor family | 1 | 7 |
3 | At4g00150.1 | 68411.m00015 scarecrow-like transcription factor 6 (SCL6) | 1 | 7 |
Rice homologs
- gnl|BL_ORD_ID|2822_24365+24463_1-20
- gnl|BL_ORD_ID|2822_24365-24463_80-99
- gnl|BL_ORD_ID|0_119695-119809_96-115
- gnl|BL_ORD_ID|0_119695+119809_1-20