IGR sequence: | igr961#chr1#x1=3960414#l=2862 |
---|---|
Mature miRNA sequence: | GAUUGAGCCGUGCCAAUAUCAC |
encoded miRNA: | MIR58 |
Precursor location: | 955 - 1038 (negative strand) |
precursor length: | 84 (30 basepairs) |
MIR position: | 63 - 84 (955 - 976) |
MIR length: | 22 (17 paired bases) |
miRNA location TIGR v3: | chr1:3961368<3961451 |
miRNA location TIGR v5: | chr1:3961368<3961451 |
Folding energy: | -36.00 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster023 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
GAGAUAUUAG UGCGGUUCAA UCAAAUAGUC GUCCUCUUAA CUCAUGGAGA ACGGUGUUGU 60 ::((((((-( --(((((((( ((-((((((( ((-((((___ _____))))- ))))--)))) ******** ********** **** UCGAUUGAGC CGUGCCAAUA UCAC 84 )-)))))))) ))--)-)))) ))::
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At2g45160.1 | 68409.m05078 scarecrow transcription factor family | 2 | 7 |
2 | At3g60630.1 | 68410.m06267 scarecrow transcription factor family | 2 | 7 |
3 | At4g00150.1 | 68411.m00015 scarecrow-like transcription factor 6 (SCL6) | 2 | 7 |
Rice homologs
- gnl|BL_ORD_ID|3254_118405-118515_90-111
- gnl|BL_ORD_ID|3254_118405+118515_1-22