IGR sequence: | igr961#chr1#x1=3960414#l=2862 |
---|---|
Mature miRNA sequence: | GAUUGAGCCGUGCCAAUAUCACG |
encoded miRNA: | MIR58b |
Precursor location: | 954 - 1039 (negative strand) |
precursor length: | 86 (32 basepairs) |
MIR position: | 64 - 86 (954 - 976) |
MIR length: | 23 (19 paired bases) |
miRNA location TIGR v3: | chr1:3961367<3961452 |
miRNA location TIGR v5: | chr1:3961367<3961452 |
Folding energy: | -36.10 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster023 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
CGAGAUAUUA GUGCGGUUCA AUCAAAUAGU CGUCCUCUUA ACUCAUGGAG AACGGUGUUG 60 ((-((((((- (--((((((( (((-(((((( (((-((((__ ______)))) -))))--))) ******* ********** ****** UUCGAUUGAG CCGUGCCAAU AUCACG 86 ))-))))))) )))--)-))) )))-))
![](../images/prec19459.png)
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At2g45160.1 | 68409.m05078 scarecrow transcription factor family | 3 | 7 |
2 | At3g60630.1 | 68410.m06267 scarecrow transcription factor family | 3 | 7 |
3 | At4g00150.1 | 68411.m00015 scarecrow-like transcription factor 6 (SCL6) | 3 | 7 |
Rice homologs
- gnl|BL_ORD_ID|2328_80669+80753_1-23
- gnl|BL_ORD_ID|2328_80669-80753_63-85
- gnl|BL_ORD_ID|2115_32492-32577_64-86
- gnl|BL_ORD_ID|2115_32492+32577_1-23
- gnl|BL_ORD_ID|1407_77115-77200_64-86
- gnl|BL_ORD_ID|1407_77115+77200_1-23