IGR sequence: | igr4835#chr1#x1=22526634#l=6090 |
---|---|
Mature miRNA sequence: | UGAUUGAGCCGUGCCAAUAUC |
encoded miRNA: | MIR46 |
Precursor location: | 3258 - 3336 (negative strand) |
precursor length: | 79 (32 basepairs) |
MIR position: | 59 - 79 (3258 - 3278) |
MIR length: | 21 (19 paired bases) |
miRNA location TIGR v3: | chr1:22529891<22529969 |
miRNA location TIGR v5: | chr1:22933763<22933841 |
Folding energy: | -44.60 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster023 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
** GAUAUUGGUG CGGUUCAAUC AGAAAACCGU ACUCUUUUGU UUUAAAGAUC GGUUUAUUUG 60 ((((((((-- (((((((((( (((((((((- --(((((___ ___)))))-) )))))-)))) ********** ********* AUUGAGCCGU GCCAAUAUC 79 )))))))))- -))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At2g45160.1 | 68409.m05078 scarecrow transcription factor family | 1 | 7 |
2 | At3g60630.1 | 68410.m06267 scarecrow transcription factor family | 1 | 7 |
3 | At4g00150.1 | 68411.m00015 scarecrow-like transcription factor 6 (SCL6) | 1 | 7 |
Rice homologs
- gnl|BL_ORD_ID|2822_24365+24463_1-21
- gnl|BL_ORD_ID|2822_24365-24463_79-99
- gnl|BL_ORD_ID|0_119694-119808_95-115
- gnl|BL_ORD_ID|0_119694+119808_1-21