IGR sequence: | igr4835#chr1#x1=22526634#l=6090 |
---|---|
Mature miRNA sequence: | UGAUUGAGCCGUGCCAAUAUCAC |
encoded miRNA: | MIR46b |
Precursor location: | 3256 - 3338 (negative strand) |
precursor length: | 83 (32 basepairs) |
MIR position: | 61 - 83 (3256 - 3278) |
MIR length: | 23 (19 paired bases) |
miRNA location TIGR v3: | chr1:22529889<22529971 |
miRNA location TIGR v5: | chr1:22933761<22933843 |
Folding energy: | -46.50 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster023 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
GAGAUAUUGG UGCGGUUCAA UCAGAAAACC GUACUCUUUU GUUUUAAAGA UCGGUUUAUU 60 ::(((((((( --(((((((( (((((((((( (---(((((_ _____))))) -))))))-)) ********** ********** *** UGAUUGAGCC GUGCCAAUAU CAC 83 )))))))))) )--))))))) )::
![](../images/prec15835.png)
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At2g45160.1 | 68409.m05078 scarecrow transcription factor family | 2 | 7 |
2 | At3g60630.1 | 68410.m06267 scarecrow transcription factor family | 2 | 7 |
3 | At4g00150.1 | 68411.m00015 scarecrow-like transcription factor 6 (SCL6) | 2 | 7 |
Rice homologs
- gnl|BL_ORD_ID|3254_118404-118514_89-111
- gnl|BL_ORD_ID|3254_118404+118514_1-23