IGR sequence: | igr1201#chr3#x1=4804107#l=2637 |
---|---|
Mature miRNA sequence: | AGCCAAGGAUGACUUGCCGG |
encoded miRNA: | MIR77 |
Precursor location: | 1618 - 1718 (negative strand) |
precursor length: | 101 (37 basepairs) |
MIR position: | 1 - 20 (1699 - 1718) |
MIR length: | 20 (19 paired bases) |
miRNA location TIGR v3: | chr3:4805724<4805824 |
miRNA location TIGR v5: | chr3:4805724<4805824 |
Folding energy: | -44.90 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster006 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** AGCCAAGGAU GACUUGCCGG UUUAAACCCA ACCGGUUUAU GACCAUUGAU UUGGUCUCAU 60 ((((((((-( (((((((((( ,,<<<<<<__ ___>>>>>>, <<<<<_____ _>>>>>,,,, UCACAAUCUG UUGAUUCGUG UCUGGCAAGU UGACCUUGGC U 101 ,<<<<<<<__ __>>>>->>> ,))))))))) ))-))))))) )
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g54160.1 | 68408.m05664 CCAAT-binding factor B subunit -related | 2 | 8 |
2 | At5g12840.1 | 68412.m08219 CCAAT box binding factor/ transcription factor Hap2a | 2 | 2 |
3 | At5g12840.2 | 68412.m08220 CCAAT box binding factor/ transcription factor Hap2a | 2 | 2 |
Rice homologs
- gnl|BL_ORD_ID|2404_2611-2700_1-20
- gnl|BL_ORD_ID|2404_2611+2700_71-90
- gnl|BL_ORD_ID|2314_13778+13867_71-90
- gnl|BL_ORD_ID|2314_13778-13867_1-20
- gnl|BL_ORD_ID|1188_62445+62548_85-104