PLAZA 3.0 Dicots : Binding Sites

Binding sites with simlar sequences

Binding site: Motif_7
Name: 3AF1BOXPSRBCS3
Description: 3AF1 binding site; tetramer in the light-responsive promoter of pea rbcS-3A gene; Box VI; One of AT-rich sequences which have been found in numerous light-regulated promoters; 3AF1 site includes a GATA motif

Sequence: AAATAGATAAATAAAAACATT
Positional Weight Matrix

Minimum similarity percentage

Binding site	Name	Description	Sequence	Similarity
Motif_84	C2GMAUX28	C2; DNase I protected sequence found in the soybean auxin responsive gene, Aux28, promoter; Located between -552 and -553; Contains (ATT)4 sequence		66.67%
Motif_611	PE1ASPHYA3	PE1; Positively acting element found at -381 to -348 of oat phyA3 promoter; A general positive element		61.90%
Motif_432	-314MOTIFZMSBE1	Located between -314 and -295 region of maize Sbe1 gene promoter; Critical positive cis element; Important for the high-level, sugar-responsive expression of the Sbe1 gene in maize endosperm cells; Recognized by nuclear protein		61.90%
Motif_355	BOXINTPATPB	Box I found in the tobacco plastid atpB gene promoter; Conserved in several NCII (nonconsensus type II) promoters of plastid genes; Important for the activity of this NCII promoter		61.90%
Motif_387	AG BS in SPL/NOZ	The homeotic protein AGAMOUS controls microsporogenesis by regulation of SPOROCYTELESS		57.14%
Motif_111	CArG1 motif in AP3	CArG1 found in the Arabidopsis APETALA3 (AP3) gene promoter; Binding site of AP3/PI heterodimer; Binding site of AP3/PI heterodimer; Binding site for a positively acting factors; MADS domain transcription factors bind with a consensus sequence called the CArG box; The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects		57.14%
Motif_551	BOX1PVCHS15	Box 1 of bean chs15 promoter; one of SBF-1 binding sites in chs15 promoter; Located at -318 to -305; Involved in organ-specific expression in plant development; Functions as a transcriptional silencer in electroporated protoplasts derived from undifferentiated suspension-cultured soybean cells; Resemble the binding site for the GT-1 factor in light-responsive elements		57.14%
Motif_328	GLUTEBP2OS	Glutelin BP-2; Binding with nuclear factors from developing seeds		52.38%
Motif_240	IBOXLSCMCUCUMISIN	I-box-like sequence found in the region (from -254 to -215) of cucumisin (a subtilisin-like serine protease) in the fruit of melon; I-box-like sequence functions as a negative regulatory element		52.38%
Motif_151	CCA1 motif2 BS in CAB1	A myb-related transcription factor is involved in the phytochrome regulation of an Arabidopsis Lhcb gene		52.38%
Motif_176	AS1LIKECSHPRA	as-1-like motif found in cucumber hydroxypyruvate reductase (hprA) gene; Required for cytokinin responsiveness; Also see CYTOSITECSHPRA		52.38%
Motif_78	SITE3SORPS1	Site 3 of spinach (S.o.) rps1 promoter; S1F binding site		52.38%