Binding site page : Motif_7
- Identifier
- Motif_7
- Name
- 3AF1BOXPSRBCS3
- Description
- 3AF1 binding site; tetramer in the light-responsive promoter of pea rbcS-3A gene; Box VI; One of AT-rich sequences which have been found in numerous light-regulated promoters; 3AF1 site includes a GATA motif
- Number of genes
- 0
- Associated publications
- Sequence
- AAATAGATAAATAAAAACATT
- Positional Weight Matrix
Binding site distribution per species
Binding site distribition per location
Toolbox
Explore
- ... associated Gene Ontology annotation of this binding site.
- ... associated InterPro annotation of this binding site.
- ... associated MapMan annotation of this binding site.
View
- ... the associated gene families.
- ... the binding sites with a similar sequence.
Gene List
Index of genes with 1 constraints:
- Binding site : Motif_7
There are no genes matching these requirements !