Binding site page : Motif_355
- Identifier
- Motif_355
- Name
- BOXINTPATPB
- Description
- Box I found in the tobacco plastid atpB gene promoter; Conserved in several NCII (nonconsensus type II) promoters of plastid genes; Important for the activity of this NCII promoter
- Number of genes
- 0
- Sequence
- AATTCCATAGAATAGATAATA
- Positional Weight Matrix
Binding site distribution per species
Binding site distribition per location
Toolbox
Explore
- ... associated Gene Ontology annotation of this binding site.
- ... associated InterPro annotation of this binding site.
- ... associated MapMan annotation of this binding site.
View
- ... the associated gene families.
- ... the binding sites with a similar sequence.
Gene List
Index of genes with 1 constraints:
- Binding site : Motif_355
There are no genes matching these requirements !