Binding site page : Motif_432
- Identifier
- Motif_432
- Name
- -314MOTIFZMSBE1
- Description
- Located between -314 and -295 region of maize Sbe1 gene promoter; Critical positive cis element; Important for the high-level, sugar-responsive expression of the Sbe1 gene in maize endosperm cells; Recognized by nuclear protein
- Number of genes
- 0
- Sequence
- ACATAAAATAAAAAAAGGCA
- Positional Weight Matrix
Binding site distribution per species
Binding site distribition per location
Toolbox
Explore
- ... associated Gene Ontology annotation of this binding site.
- ... associated InterPro annotation of this binding site.
- ... associated MapMan annotation of this binding site.
View
- ... the associated gene families.
- ... the binding sites with a similar sequence.
Gene List
Index of genes with 1 constraints:
- Binding site : Motif_432
There are no genes matching these requirements !