PLAZA 3.0 Dicots : Binding Sites

Binding sites with simlar sequences

Binding site: Motif_170
Name: OBF4-5 BS in GST6
Description: OBF5 (ocs element binding factor 5) binding site found in the Arabidopsis GST6 gene promoter; Similar to Ocs sequence; Located between -426 and -401; Overexpression of OBP3 lead to severe growth defect with altered root development and yellowish leaves; All OBP proteins contain transcriptional activation domains in their C-terminal region; Dof protein play important roles in plant growth and development; Binding site of OBF4 and OBF5;The promoter of a H202-inducible, Arabidopsis glutathione S-transferase gene contains closely linked OBF- and OBP1-binding sites

Sequence: ATCTTATGTCATTGATGACGACCTCC
Positional Weight Matrix

Minimum similarity percentage

Binding site	Name	Description	Similarity
Motif_113	AS1CAMV	as-1 (activation sequence 1) in CaMV 35S promoter; from -85 to -58 (subdomain AI); Binding with ASF-1 (activation sequence factor 1) from pea and tobacco; Expression in root and leaf	57.69%
Motif_548	SARECAMV	Salicylic acid responsive element found in CaMV 35S promoter; Identical to as-1; Binding with ASF-1 (Activation Sequence Factor-1); See AS1	57.69%
Motif_481	GLUTEBOX1OSGT2	Box 1 of rice glutelin Gt2 gene family promoter regions; nuclear factor binding site	57.69%
Motif_398	GLUTEBOX1OSGT3	Box 1 of rice glutelin Gt3 gene family promoter region; See S000128 GLUTEBOX2A	53.85%
Motif_66	ESPASGL01	ESP (endosperm specificity palindrome) element found in the promoter of oat (A.s.) globulin gene (AsGlo1)	50.00%
Motif_466	-141NTG13	-141 sequence; Binding site of tobacco TGA1a-related protein,PG13, found in the G13 gene promoter; PG13 (Protein encoded by G13) shows high homology to TGA1a; ASF-1, PG13, and TGA1a bind to the same target sequence in the 5' upstream region of G13	50.00%
Motif_276	LREBOX3PSRBCS3	LRE (light-responsive element) Box III of pea rbcS-3A gene; GT-1 binding	50.00%
Motif_185	CArG2 motif in AP3	CArG2 found in the Arabidopsis APETALA3 (AP3) gene promoter; Mutations in CArG2 result in a decrease in the expression in petals, but the expression pattern in stamens is unchanged; The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects	50.00%
Motif_77	IDE1HVIDS2	IDE1 (iron-deficiency-responsive element 1) found at -153/-136 of barley IDS2 (iron deficiency specific clone 2) gene promoter	50.00%
Motif_302	OCSGMHSP26A	Ocs element found in soybean (Glycine max) heat shock gene (Gmhsp26-A) promoter; The element is a functional ocs-element; The element did not affect the promoter's response to heat or wounding	50.00%
Motif_493	ABFOS	ABF (as-1-like box binding factor) binding site; as-1-like (ASL) box is found at -98 to -79 of RTBV (rice tungro bacilliform virus) promoter; ASL box is required for phloem-specific gene expression of Rice Tungro Bacilliform Virus (RTBV)	50.00%
Motif_479	TGA1ANTPR1A	TGA1a binding site in tobacco PR1a gene; as-1-like sequence; Contains two TGACG elements reminiscent of activation sequence-1 (as-1); See other as-1-like sequences; TGA1a is preferentially expressed in root tip meristems; TGA1a may contribute to the expression of GST isoenzymes, especially in root tip meristems	50.00%
Motif_217	PIIATGAPB	PII found in the Arabidopsis thaliana GAPB gene promoter; Located between -69 and -50; Mutations in the PII resulted in reductions of light-activated gene transcription; GAPB encodes the B subunit of chloroplast glyceraldehyde-3-phosphate dehydrogenase(GADPH) of A.T.; Promoter analysis of the nuclear gene encoding the chloroplast glyceraldehyde-3-phosphate dehydrogenase B subunit of Arabidopsis thaliana	50.00%
Motif_68	PASNTPARA	pas; as-1-related element found in the tobacco parA gene promoter; Involved in Cadmium responsiveness; Not related to copper responsiveness; Located between -68 and -49	50.00%