Binding site page : Motif_170
- Identifier
- Motif_170
- Name
- OBF4-5 BS in GST6
- Description
- OBF5 (ocs element binding factor 5) binding site found in the Arabidopsis GST6 gene promoter; Similar to Ocs sequence; Located between -426 and -401; Overexpression of OBP3 lead to severe growth defect with altered root development and yellowish leaves; All OBP proteins contain transcriptional activation domains in their C-terminal region; Dof protein play important roles in plant growth and development; Binding site of OBF4 and OBF5;The promoter of a H202-inducible, Arabidopsis glutathione S-transferase gene contains closely linked OBF- and OBP1-binding sites
- Number of genes
- 0
- Sequence
- ATCTTATGTCATTGATGACGACCTCC
- Positional Weight Matrix
Binding site distribution per species
Binding site distribition per location
Toolbox
Explore
- ... associated Gene Ontology annotation of this binding site.
- ... associated InterPro annotation of this binding site.
- ... associated MapMan annotation of this binding site.
View
- ... the associated gene families.
- ... the binding sites with a similar sequence.
Associated Transcription Factors
Transcription factor | Alias | Description | Orthologs | Associated motifs |
---|---|---|---|---|
AT5G06960 | OCS-element binding factor 5 | Q39163;TGA5 | View orthologs | View associated binding sites |
AT5G10030 | TGACG motif-binding factor 4 | Q39162;OCS ELEMENT BINDING FACTOR 4 | View orthologs | View associated binding sites |
Gene List
Index of genes with 1 constraints:
- Binding site : Motif_170
There are no genes matching these requirements !