IGR sequence: | igr3097#chr5#x1=15478185#l=2723 |
---|---|
Mature miRNA sequence: | CAGCCAAGGAUGACUUGCCG |
encoded miRNA: | MIR87 |
Precursor location: | 662 - 874 (negative strand) |
precursor length: | 213 (73 basepairs) |
MIR position: | 1 - 20 (855 - 874) |
MIR length: | 20 (18 paired bases) |
miRNA location TIGR v3: | chr5:15478846<15479058 |
miRNA location TIGR v5: | chr5:15887904<15888116 |
Folding energy: | -70.32 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster006 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** CAGCCAAGGA UGACUUGCCG GUAGCUUGUA UUAUGAUUAC UCUAUAUUCG AUUUAUAUUA 60 :(((((-((( (((((((((( ((((((((,, ,,<<-<<<<< <<<<<<____ ________>> UGGAGAUGAU GGUUUAUAUA UAUUUACUUA UCUACAUAGU UUUAGUUGAU UUUUUUUCGU 120 >>>>>->>>> ->>,,,,,<< <<<<<-<<<< -<<<<<<<-- ---<<<-<<< -<<<<<<<<< ACGUAAUAUA AUACGAAAAA GUAUUUACUU AUUUAUAUAU GUGUGUUGGG GCAAGAAGUG 180 <_________ _>>>>>>>>> >->>>->>>- ------->>> >>>->->>>> ----->>>>> UAACCAAGCU AGCCCGGCAA GUCAUCUAUG GCU 213 >>,,)))))) )--))))))) )))))))-)) )))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g17590.1 | 68408.m01959 transcription factor -related | 2 | 10 |
2 | At1g54160.1 | 68408.m05664 CCAAT-binding factor B subunit -related | 2 | 8 |
Rice homologs
- gnl|BL_ORD_ID|430_45524-45617_1-20
- gnl|BL_ORD_ID|430_45523+45617_76-95