IGR sequence: | igr2356#chr3#x1=9872012#l=10062 |
---|---|
Mature miRNA sequence: | UAGCCAAGGAUGACUUGCCU |
encoded miRNA: | MIR57 |
Precursor location: | 5150 - 5296 (negative strand) |
precursor length: | 147 (54 basepairs) |
MIR position: | 1 - 20 (5277 - 5296) |
MIR length: | 20 (18 paired bases) |
miRNA location TIGR v3: | chr3:9877161<9877307 |
miRNA location TIGR v5: | chr3:9877151<9877297 |
Folding energy: | -61.44 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster006 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** UAGCCAAGGA UGACUUGCCU GAUCUUUUUC ACCUCCAUGA UUCAAUUUUA AGUUCGUGGA 60 (((((((((( -((((-(((( ((-(((---- ((((-((-(( ((((((---- --------(( UUUUGGAUUA UUAUGCGUUU AAAAGGUAUA AUAAUUUGAG AUCAUGUUGA AUCUUGCGGG 120 (((--((((( ((((((-(__ ___)-))))) ))))))--)) )))--))))) )))-))-))) UUAGGUUUCA GGCAGUCUCU UUGGCUA 147 )-)))--))) )))))))))) )))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g17590.1 | 68408.m01959 transcription factor -related | 2 | 10 |
2 | At1g54160.1 | 68408.m05664 CCAAT-binding factor B subunit -related | 2 | 8 |
3 | At1g72830.1 | 68408.m07728 CCAAT-binding factor B subunit homolog -related | 2 | 8 |
Rice homologs
- gnl|BL_ORD_ID|2510_67224-67328_1-20
- gnl|BL_ORD_ID|2510_67224+67328_86-105
- gnl|BL_ORD_ID|2154_158032-158181_1-20
- gnl|BL_ORD_ID|2154_158032+158181_131-150
- gnl|BL_ORD_ID|323_84895+85044_131-150
- gnl|BL_ORD_ID|323_84895-85044_1-20