IGR sequence: | igr2356#chr3#x1=9872012#l=10062 |
---|---|
Mature miRNA sequence: | GUAGCCAAGGAUGACUUGCCU |
encoded miRNA: | MIR13 |
Precursor location: | 1593 - 1740 (negative strand) |
precursor length: | 148 (54 basepairs) |
MIR position: | 1 - 21 (1720 - 1740) |
MIR length: | 21 (19 paired bases) |
miRNA location TIGR v3: | chr3:9873604<9873751 |
miRNA location TIGR v5: | chr3:9873594<9873741 |
Folding energy: | -65.04 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster006 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** * GUAGCCAAGG AUGACUUGCC UGAUCUUUUU CACCUCCAUG AUUCAAUUUG UAAUUCAUGG 60 (((((((((( (-((((-((( (((-(((--- -((((-((-( (((((((--- ---------( GUUUUGGAUU AUUAUACAUU CAAAAGUAUA AUAAUUUGAA AUCAUGUUGA AUCUUGCGGG 120 ((((--(((( (((((((___ _____))))) ))))))--)) )))--))))) )))-))-))) UUAGGUUUCA GGCAGUCUCC UUGGCUAU 148 )-)))--))) )))))))))) ))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g17590.1 | 68408.m01959 transcription factor -related | 2 | 10 |
2 | At1g54160.1 | 68408.m05664 CCAAT-binding factor B subunit -related | 2 | 8 |
3 | At1g72830.1 | 68408.m07728 CCAAT-binding factor B subunit homolog -related | 2 | 8 |
Rice homologs
- gnl|BL_ORD_ID|2510_67223-67328_1-21
- gnl|BL_ORD_ID|2510_67223+67328_86-106
- gnl|BL_ORD_ID|2154_158030-158181_1-21
- gnl|BL_ORD_ID|2154_158031+158181_131-151
- gnl|BL_ORD_ID|323_84895+85045_131-151
- gnl|BL_ORD_ID|323_84894-85045_1-21