IGR sequence: | igr2356#chr3#x1=9872012#l=10062 |
---|---|
Mature miRNA sequence: | GUAGCCAAGGAUGACUUGCCUG |
encoded miRNA: | MIR13b |
Precursor location: | 1593 - 1740 (negative strand) |
precursor length: | 148 (54 basepairs) |
MIR position: | 1 - 22 (1719 - 1740) |
MIR length: | 22 (20 paired bases) |
miRNA location TIGR v3: | chr3:9873604<9873751 |
miRNA location TIGR v5: | chr3:9873594<9873741 |
Folding energy: | -65.04 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster006 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ** GUAGCCAAGG AUGACUUGCC UGAUCUUUUU CACCUCCAUG AUUCAAUUUG UAAUUCAUGG 60 (((((((((( (-((((-((( (((-(((--- -((((-((-( (((((((--- ---------( GUUUUGGAUU AUUAUACAUU CAAAAGUAUA AUAAUUUGAA AUCAUGUUGA AUCUUGCGGG 120 ((((--(((( (((((((___ _____))))) ))))))--)) )))--))))) )))-))-))) UUAGGUUUCA GGCAGUCUCC UUGGCUAU 148 )-)))--))) )))))))))) ))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g17590.1 | 68408.m01959 transcription factor -related | 3 | 10 |
2 | At1g54160.1 | 68408.m05664 CCAAT-binding factor B subunit -related | 3 | 8 |
3 | At1g72830.1 | 68408.m07728 CCAAT-binding factor B subunit homolog -related | 3 | 8 |
Rice homologs
- gnl|BL_ORD_ID|3514_19526-19630_1-22
- gnl|BL_ORD_ID|3514_19526+19630_84-105
- gnl|BL_ORD_ID|3443_19526-19630_1-22
- gnl|BL_ORD_ID|3443_19526+19630_84-105
- gnl|BL_ORD_ID|2878_55663+55767_84-105
- gnl|BL_ORD_ID|2878_55663-55767_1-22
- gnl|BL_ORD_ID|2113_123478-123579_1-22
- gnl|BL_ORD_ID|2113_119291-119379_1-22
- gnl|BL_ORD_ID|2113_119291+119379_68-89
- gnl|BL_ORD_ID|2113_130010-130127_1-22
- gnl|BL_ORD_ID|2113_130010+130127_97-118
- gnl|BL_ORD_ID|990_62773-62874_1-22
- gnl|BL_ORD_ID|990_58586-58674_1-22
- gnl|BL_ORD_ID|990_58586+58674_68-89
- gnl|BL_ORD_ID|990_69305-69422_1-22
- gnl|BL_ORD_ID|990_69305+69422_97-118