IGR sequence: | igr1929#chr5#x1=8503345#l=5327 |
---|---|
Mature miRNA sequence: | UGCAGCCAAGGAUGACUUGCCG |
encoded miRNA: | MIR81 |
Precursor location: | 1912 - 2016 (positive strand) |
precursor length: | 105 (39 basepairs) |
MIR position: | 1 - 22 (1912 - 1933) |
MIR length: | 22 (18 paired bases) |
miRNA location TIGR v3: | chr5:8505256>8505360 |
miRNA location TIGR v5: | chr5:8527512>8527616 |
Folding energy: | -45.10 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster006 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ** UGCAGCCAAG GAUGACUUGC CGGAACGUUG UUAACCAUGC AUAUGAAUAA UGUGAUGAUU 60 :(-((((((( ((--(((((( (((((---(( ((---(((-( ((((((-((( (______))) AAUUAUGUGA UGAACAUAUU UCUGGCAAGU UGUCCUUCGG CUACA 105 )-)))))))) ))))))---) )))))))))) --)))))-)) ))-):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g17590.1 | 68408.m01959 transcription factor -related | 3 | 10 |
2 | At1g54160.1 | 68408.m05664 CCAAT-binding factor B subunit -related | 3 | 8 |
Rice homologs
- gnl|BL_ORD_ID|430_45596+45694_1-22