IGR sequence: | igr795#chr5#x1=3454190#l=5083 |
---|---|
Mature miRNA sequence: | UGACAGAAGAGAGUGAGCACACA |
encoded miRNA: | MIR17d |
Precursor location: | 2459 - 2544 (negative strand) |
precursor length: | 86 (34 basepairs) |
MIR position: | 1 - 23 (2522 - 2544) |
MIR length: | 23 (21 paired bases) |
miRNA location TIGR v3: | chr5:3456648<3456733 |
miRNA location TIGR v5: | chr5:3456648<3456733 |
Folding energy: | -44.40 |
BLAST hit against RFAM Atha miRNAs: | ath-MIR156d |
Belongs to miRNAs-targets cluster: | cluster019 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** *** UGACAGAAGA GAGUGAGCAC ACAAAGGGGA AGUUGUAUAA AAGUUUUGUA UAUGGUUGCU 60 :((((((((( (((((((((( -((((((-(( ---((((((( _____))))) ))---))-)) UUUGCGUGCU CACUCUCUUU UUGUCA 86 ))))-))))) )))))))-)) ))))):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g53160.1 | 68408.m05523 transcription factor -related | 2 | 8 |
2 | At2g42200.1 | 68409.m05466 squamosa-promoter binding protein -related | 3 | 8 |
3 | At2g42200.2 | 68409.m05467 squamosa-promoter binding protein -related | 3 | 8 |
4 | At3g57920.1 | 68410.m05967 squamosa promoter-binding protein homolog | 3 | 8 |
5 | At5g50570.1 | 68412.m07940 expressed protein | 3 | 8 |
6 | At5g50570.2 | 68412.m07941 expressed protein | 3 | 8 |
7 | At5g50670.1 | 68412.m05668 expressed protein | 3 | 8 |
Rice homologs
- gnl|BL_ORD_ID|2024_146441+146550_88-110
- gnl|BL_ORD_ID|2024_146441-146550_1-23
- gnl|BL_ORD_ID|2021_81256-81365_1-23
- gnl|BL_ORD_ID|2021_81256+81365_88-110
- gnl|BL_ORD_ID|490_72536-72621_1-23
- gnl|BL_ORD_ID|490_72536+72621_64-86
- gnl|BL_ORD_ID|490_72533+72621_67-89
- gnl|BL_ORD_ID|490_72541+72621_59-81
- gnl|BL_ORD_ID|490_72151-72241_1-23
- gnl|BL_ORD_ID|490_72151+72241_69-91
- gnl|BL_ORD_ID|490_72147+72241_73-95
- gnl|BL_ORD_ID|457_25565-25650_1-23
- gnl|BL_ORD_ID|457_25565+25650_64-86
- gnl|BL_ORD_ID|457_25562+25650_67-89
- gnl|BL_ORD_ID|457_25570+25650_59-81
- gnl|BL_ORD_ID|457_25180-25270_1-23
- gnl|BL_ORD_ID|457_25180+25270_69-91
- gnl|BL_ORD_ID|457_25176+25270_73-95