IGR sequence: | igr4079#chr2#x1=18941708#l=2762 |
---|---|
Mature miRNA sequence: | UUGGAUUGAAGGGAGCUCCU |
encoded miRNA: | MIR88 |
Precursor location: | 1395 - 1599 (positive strand) |
precursor length: | 205 (73 basepairs) |
MIR position: | 186 - 205 (1580 - 1599) |
MIR length: | 20 (18 paired bases) |
miRNA location TIGR v3: | chr2:18943102>18943306 |
miRNA location TIGR v5: | chr2:19001715>19001919 |
Folding energy: | -87.80 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster034 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
AGGAGCUCCC UUCCUCCAAA ACGAAGAGGA CAAGAUUUGA GGAACUAAAA UGCAGAAUCU 60 (((((((((( (((-(((((( -((((((((( ---(((--(( ((((------ -(-((((((( AAGAGUUCAU GUCUUCCUCA UAGAGAGUGC GCGGUGUUAA AAGCUUGAAG AAAGCACACU 120 (((((-((-( ((--(((((- (((((-(((( ------(((( ____))))-- ---))))-)) UUAAGGGGAU UGCACGACCU CUUAGAUUCU CCCUCUUUCU CUACAUAUCA UUCUCUUCUC 180 )))-)))))- -)))-))-)) )))))))))) )----))))) )-----)))- -----))))) ***** ********** ***** UUCGUUUGGA UUGAAGGGAG CUCCU 205 )))))))))) --)))))))) )))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At2g26950.1 | 68409.m02933 myb family transcription factor | 2 | 1 |
2 | At3g11440.1 | 68410.m01260 myb family transcription factor | 2 | 1 |
3 | At3g33076.1 | 68410.m03915 retrotransposon gag protein family | 2 | 1 |
4 | At5g06100.1 | 68412.m00630 myb family transcription factor | 2 | 1 |
5 | At5g06100.2 | 68412.m00631 myb family transcription factor | 2 | 1 |
6 | At5g55020.1 | 68412.m06200 expressed protein | 2 | 1 |
Rice homologs
- gnl|BL_ORD_ID|479_23793-23963_1-20
- gnl|BL_ORD_ID|479_23793+23963_152-171