At3g11440.1

At3g11440.1 68410.m01260 myb family transcription factor

Matching miRNAs:
miRNA nameIGR namemature miRNA sequenceTargetsRfam
1prec14336igr4079#chr2#x1=18941708#l=2762_1395+1599TTGGATTGAAGGGAGCTCCT6

Gene Sequence:

guuacuuuga ucucuuucuc cauccuuguc ucugucgauu cucugagaua ucuucucucg     60 
.......... .......... .......... .......... .......... ..........        prec14336

agcuuuuucc cgcguuaucu cucucccacu ccugguugga gcuugauguc uaaauuguua    120 
.......... .......... .......... .......... .......... ..........        prec14336

uugaacugcu ggagucuguc uugcuuuaag uagaaagagA UGAGUUACAC GACGGCGACU    180 
.......... .......... .......... .......... .......... ..........        prec14336

GCUGAUAGUG AUGAUGGUAU GCACUCCAGC AUCCAUAAUG AAUCACCAGC UCCUGAUAGU    240 
.......... .......... .......... .......... .......... ..........        prec14336

AUUAGCAAUG GCUGCAGAAG UAGAGGGAAA AGAAGUGUCC UGAAGAAAGG ACCAUGGACU    300 
.......... .......... .......... .......... .......... ..........        prec14336

UCAACUGAAG ACGGGAUUUU AAUUGAUUAU GUAAAGAAGC ACGGCGAGGG UAACUGGAAU    360 
.......... .......... .......... .......... .......... ..........        prec14336

GCUGUGCAGA AACACACUAG CCUGGCCCGU UGUGGUAAAA GCUGUCGUCU GAGAUGGGCU    420 
.......... .......... .......... .......... .......... ..........        prec14336

AAUCAUCUGA GGCCAAACUU GAAGAAAGGA GCAUUUAGCC AAGAAGAAGA ACAGCUCAUU    480 
.......... .......... .......... .......... .......... ..........        prec14336

GUUGAAAUGC ACGCCAAGAU GGGAAAUAAA UGGGCACAGA UGGCUGAACA UUUACCUGGU    540 
.......... .......... .......... .......... .......... ..........        prec14336

CGAACAGAUA AUGAGAUAAA GAAUUAUUGG AACACUCGUA UCAAGAGGAG ACAACGAGCA    600 
.......... .......... .......... .......... .......... ..........        prec14336

GGCUUACCAC UUUACCCUCC UGAAAUCUAU GUUGAUGACC UUCAUUGGAG CGAAGAGUAU    660 
.......... .......... .......... .......... .......... ..........        prec14336

ACAAAGAGUA AUAUCAUAAG AGUAGAUAGA AGAAGAAGAC AUCAAGAUUU CUUGCAGUUG    720 
.......... .......... .......... .......... .......... ..........        prec14336

GGGAAUUCUA AAGAUAAUGU CUUAUUUGAC GAUCUAAAUU UUGCUGCUAG CUUGUUACCU    780 
.......... .......... .......... .......... .......... ..........        prec14336

GCCGCUUCUG ACCUAUCAGA UUUGGUUGCA UGCAACAUGC UAGGAACUGG CGCAAGUUCU    840 
.......... .......... .......... .......... .......... ..........        prec14336

UCCCGGUAUG AGAGCUACAU GCCACCAAUA UUGCCUUCCC CAAAGCAAAU CUGGGAAUCU    900 
.......... .......... .......... .......... .......... ..........        prec14336

GGAUCUCGGU UUCCCAUGUG CAGCAGUAAC AUAAAGCAUG AAUUCCAAUC GCCGGAACAC    960 
.......... .......... .......... .......... .......... ..........        prec14336

UUUCAGAAUA CGGCUGUACA GAAGAAUCCC AGAUCUUGCA GUAUCUCGCC UUGUGAUGUU   1020 
.......... .......... .......... .......... .......... ..........        prec14336

GAUCAUCAUC CUUAUGAAAA CCAACAUUCG UCUCAUAUGA UGAUGGUUCC UGAUAGCCAU   1080 
.......... .......... .......... .......... .......... ..........        prec14336

ACAGUUACGU AUGGCAUGCA UCCUACUUCU AAGCCCUUGU UUGGGGCAGU GAAGCUGGAG   1140 
.......... .......... .......... .......... .......... .....*****        prec14336

CUCCCUUCAU UCCAAUAUUC AGAAACUAGU GCAUUUGAUC AGUGGAAGAC GACUCCGUCA   1200 
********** *****..... .......... .......... .......... ..........        prec14336

CCUCCACACU CAGAUCUCCU UGACUCUGUU GAUGCCUAUA UUCAAUCUCC ACCACCAUCG   1260 
.......... .......... .......... .......... .......... ..........        prec14336

CAGGUAGAGG AGUCAGAUUG UUUCUCUUCA UGCGACACCG GCCUACUAGA UAUGUUACUU   1320 
.......... .......... .......... .......... .......... ..........        prec14336

CAUGAGGCCA AGAUCAAAAC UAGUGCGAAG CACAGUUUGU UGAUGUCAUC ACCCCAGAAG   1380 
.......... .......... .......... .......... .......... ..........        prec14336

AGUUUCAGUU CAACUACUUG CACGACCAAU GUUACUCAGA AUGUACCACG UGGCAGCGAA   1440 
.......... .......... .......... .......... .......... ..........        prec14336

AACCUGAUCA AAUCAGGAGA AUAUGAAGAU UCCCAAAAGU AUUUGGGUCG CUCCGAGAUU   1500 
.......... .......... .......... .......... .......... ..........        prec14336

ACAAGUCCCU CGCAACUUAG UGCAGGUGGU UUUUCAUCAG CUUUUGCAGG GAAUGUUGUA   1560 
.......... .......... .......... .......... .......... ..........        prec14336

AAGACAGAAG AGUUGGAUCA GGUUUGGGAA CCAAAGAGAG UUGAUAUAAC ACGGCCUGAU   1620 
.......... .......... .......... .......... .......... ..........        prec14336

GUUUUACUUG CGUCGAGCUG GCUUGACCAA GGCUGUUAUG GCAUUGUUAG UGACACAAGC   1680 
.......... .......... .......... .......... .......... ..........        prec14336

AGCAUGAGUG AUGCGCUUGC ACUUCUUGGU GGUGACGACA UUGGGAACAG UUACGUGACU   1740 
.......... .......... .......... .......... .......... ..........        prec14336

GUUGGGUCAU CAUCAGGUCA AGCACCACGA GGCGUCGGGU CUUAUGGAUG GACCAAUAUG   1800 
.......... .......... .......... .......... .......... ..........        prec14336

CCUCCUGUUU GGUCGCUGUA Acaaaaugaa ccauaucaca caauuugaau cuuucuguau   1860 
.......... .......... .......... .......... .......... ..........        prec14336

uuucaugcac cuggcuuaca ugacuuggug guuuguuaua guugagagaa gauuugugga   1920 
.......... .......... .......... .......... .......... ..........        prec14336

cuugguaaaa auuuggauuu ucuucaccug auuuuucuua uacuuggaag gcauuuauau   1980 
.......... .......... .......... .......... .......... ..........        prec14336

auacucauuu cuuguuc  1997 
.......... .......       prec14336