IGR sequence: | igr3768#chr5#x1=18615936#l=2646 |
---|---|
Mature miRNA sequence: | UAUGCCUGGCUCCCUGUAUGCCAC |
encoded miRNA: | MIR40 |
Precursor location: | 1330 - 1414 (negative strand) |
precursor length: | 85 (33 basepairs) |
MIR position: | 1 - 24 (1391 - 1414) |
MIR length: | 24 (22 paired bases) |
miRNA location TIGR v3: | chr5:18617265<18617349 |
miRNA location TIGR v5: | chr5:19026323<19026407 |
Folding energy: | -45.80 |
BLAST hit against RFAM Atha miRNAs: | ath-MIR160c |
Belongs to miRNAs-targets cluster: | cluster017 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** **** UAUGCCUGGC UCCCUGUAUG CCACGAGUGG AUACCGAUUU UGGUUUUAAA AUCGGCUGCC 60 (((((-(((( (((-(((((( ((((--(--( ---((((((( ((____)))) ))))))--)- GGUGGCGUAC AAGGAGUCAA GCAUG 85 -))))))))) )-)))))))- )))))

Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g77850.1 | 68408.m08325 transcriptional factor B3 family | 4 | 7 |
2 | At4g30080.1 | 68411.m03904 transcription factor-related protein | 4 | 3 |
Rice homologs
- gnl|BL_ORD_ID|46_2634-2767_1-24
- gnl|BL_ORD_ID|16_152085-152218_1-24