IGR sequence: | igr3494#chr2#x1=16598245#l=6010 |
---|---|
Mature miRNA sequence: | UCCAAAGGGAUCGCAUUGAUC |
encoded miRNA: | MIR20 |
Precursor location: | 2332 - 2444 (positive strand) |
precursor length: | 113 (36 basepairs) |
MIR position: | 1 - 21 (2332 - 2352) |
MIR length: | 21 (19 paired bases) |
miRNA location TIGR v3: | chr2:16600576>16600688 |
miRNA location TIGR v5: | chr2:16659189>16659301 |
Folding energy: | -34.70 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster009 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** * UCCAAAGGGA UCGCAUUGAU CCUAAUUAAG GUGAAUUCUC CCCAUAUUUU CUUUAUAAUU 60 (((((((((( (-((((-((( ((-(((((,< <-<<____>> ->>,,,,,,, ,,,,,,,,,, GGCAAAUAAA UCACAAAAAU UUGCUUGGUU UUGGAUCAUG CUAUCUCUUU GGA 113 <<<<<<<___ ________>> >>>>>))))) --)))))))) )-)))))))) )))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g12820.1 | 68408.m01345 transport inhibitor response 1 (TIR1), putative | 2 | 2 |
2 | At3g26810.1 | 68410.m03071 transport inhibitor response 1 (TIR1), putative | 2 | 2 |
Rice homologs
- gnl|BL_ORD_ID|2699_72476-72570_75-95
- gnl|BL_ORD_ID|2699_72476+72570_1-21
- gnl|BL_ORD_ID|2325_26142-26236_75-95
- gnl|BL_ORD_ID|2325_26142+26236_1-21