IGR sequence: | igr3459#chr5#x1=17123821#l=3126 |
---|---|
Mature miRNA sequence: | UCGGACCAGGCUUCAUUCCCCUCA |
encoded miRNA: | MIR70 |
Precursor location: | 727 - 1085 (positive strand) |
precursor length: | 359 (115 basepairs) |
MIR position: | 1 - 24 (727 - 750) |
MIR length: | 24 (21 paired bases) |
miRNA location TIGR v3: | chr5:17124547>17124905 |
miRNA location TIGR v5: | chr5:17533605>17533963 |
Folding energy: | -105.52 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster027 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** **** UCGGACCAGG CUUCAUUCCC CUCAACUUAC ACGUUUUGCU UCUCAAUCUU CAAGACCAAU 60 ::(((((((( ((((-((((( (((((((((( ,,<<<<<<__ __________ >>>>>>,,,, CGUUAGCCGA UCACCUAAUU CUCUAGUAAG CCAAGAAAGA UGAACAUAAA UGGUGUAUCC 120 ,,,,,,,,<< <<-------- <<<<-<<<,, ,,[[[[[[[[ [[[--[[[-[ [[[_____]] GUGUAUAUCA UCUUUUUUUG UAUGUAUGCG UCUUUCAUCA UCAAUCCGCA GCAAUGUAUA 180 ]]-]]]-]]] ]]]]]]]][[ [[[[[[[[[[ [,,,,,,,,, ,,,,,,,,{{ {{{{-{{--- UAAUAUGGUG UAUAUCAAAA ACACAUUAGG CAUAUCUAUU AAAAUUGUUU CCUUAAUAUA 240 {{{{{-{{{{ {{{-----{{ {{{---{{{{ ____}}}}-- -----}}}}} -----}}}}} UCUGUUAAAC CUUGCUGAUU AAGAGAAAUA AUAUAAUCGA AAUUUCUUUU GACAUGCAUG 300 }}}}}}}-}} -}}}}}},{{ {{{{{{{{{_ __________ _}}}}}}}}} }},]]]]]]] CAUAUAUAUA AGAGUAACAG AUCACCGAGU AAAGUUGAGG GGAAGGAAGC CUGGUUUAA 359 ]]]]]]>>>- >>>>-----> >>>,,,,,)) -))))))))) ))))-))))) )))))))::
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g30490.1 | 68408.m03374 HD-Zip transcription factor Athb-9 | 4 | 1 |
2 | At1g52150.1 | 68408.m08708 HD-Zip transcription factor | 4 | 2 |
3 | At1g52150.2 | 68408.m08709 HD-Zip transcription factor | 4 | 2 |
4 | At2g34710.1 | 68409.m03852 HD-Zip transcription factor Athb-14 | 4 | 1 |
Rice homologs
- gnl|BL_ORD_ID|31_95956-96072_94-117