PLAZA 3.0 Dicots : Binding Sites

Binding sites with simlar sequences

Binding site: Motif_432
Name: -314MOTIFZMSBE1
Description: Located between -314 and -295 region of maize Sbe1 gene promoter; Critical positive cis element; Important for the high-level, sugar-responsive expression of the Sbe1 gene in maize endosperm cells; Recognized by nuclear protein

Sequence: ACATAAAATAAAAAAAGGCA
Positional Weight Matrix

Minimum similarity percentage

Binding site	Name	Description	Sequence	Similarity
Motif_84	C2GMAUX28	C2; DNase I protected sequence found in the soybean auxin responsive gene, Aux28, promoter; Located between -552 and -553; Contains (ATT)4 sequence		65.00%
Motif_7	3AF1BOXPSRBCS3	3AF1 binding site; tetramer in the light-responsive promoter of pea rbcS-3A gene; Box VI; One of AT-rich sequences which have been found in numerous light-regulated promoters; 3AF1 site includes a GATA motif		60.00%
Motif_551	BOX1PVCHS15	Box 1 of bean chs15 promoter; one of SBF-1 binding sites in chs15 promoter; Located at -318 to -305; Involved in organ-specific expression in plant development; Functions as a transcriptional silencer in electroporated protoplasts derived from undifferentiated suspension-cultured soybean cells; Resemble the binding site for the GT-1 factor in light-responsive elements		55.00%
Motif_151	CCA1 motif2 BS in CAB1	A myb-related transcription factor is involved in the phytochrome regulation of an Arabidopsis Lhcb gene		55.00%
Motif_449	AGL25; SVP	FLOWERING LOCUS C (FLC) regulates development pathways throughout the life cycle of Arabidopsis. Genome-wide identification of SOC1 and SVP targets during the floral transition in Arabidopsis		55.00%
Matrix_364	FLC	Not Available		52.85%
Motif_176	AS1LIKECSHPRA	as-1-like motif found in cucumber hydroxypyruvate reductase (hprA) gene; Required for cytokinin responsiveness; Also see CYTOSITECSHPRA		50.00%
Motif_679	SB1NPABC1	Sclareol box1 (SB1) found at -827 of a plasma membrane ATP binding cassette (ABC) transporter gene (NpABC1) in N. plumbaginifolia; Mutation in SB3 completely abolished sclareolide-mediated expression		50.00%
Motif_611	PE1ASPHYA3	PE1; Positively acting element found at -381 to -348 of oat phyA3 promoter; A general positive element		50.00%
Motif_387	AG BS in SPL/NOZ	The homeotic protein AGAMOUS controls microsporogenesis by regulation of SPOROCYTELESS		50.00%
Motif_240	IBOXLSCMCUCUMISIN	I-box-like sequence found in the region (from -254 to -215) of cucumisin (a subtilisin-like serine protease) in the fruit of melon; I-box-like sequence functions as a negative regulatory element		50.00%
Motif_44	AGL25	FLOWERING LOCUS C (FLC) regulates development pathways throughout the life cycle of Arabidopsis		50.00%
Motif_45	AGL25; SOC1	FLOWERING LOCUS C (FLC) regulates development pathways throughout the life cycle of Arabidopsis;Genome-wide identification of SOC1 and SVP targets during the floral transition in Arabidopsis		50.00%
Motif_78	SITE3SORPS1	Site 3 of spinach (S.o.) rps1 promoter; S1F binding site		50.00%