PLAZA 3.0 Dicots : Binding Sites

Binding sites with simlar sequences

Binding site: Motif_355
Name: BOXINTPATPB
Description: Box I found in the tobacco plastid atpB gene promoter; Conserved in several NCII (nonconsensus type II) promoters of plastid genes; Important for the activity of this NCII promoter

Sequence: AATTCCATAGAATAGATAATA
Positional Weight Matrix

Minimum similarity percentage

Binding site	Name	Description	Similarity
Motif_111	CArG1 motif in AP3	CArG1 found in the Arabidopsis APETALA3 (AP3) gene promoter; Binding site of AP3/PI heterodimer; Binding site of AP3/PI heterodimer; Binding site for a positively acting factors; MADS domain transcription factors bind with a consensus sequence called the CArG box; The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects	66.67%
Motif_84	C2GMAUX28	C2; DNase I protected sequence found in the soybean auxin responsive gene, Aux28, promoter; Located between -552 and -553; Contains (ATT)4 sequence	66.67%
Motif_387	AG BS in SPL/NOZ	The homeotic protein AGAMOUS controls microsporogenesis by regulation of SPOROCYTELESS	61.90%
Motif_613	SB3NPABC1	Sclareol box3 (SB3) found at -216 of a plasma membrane ATP binding cassette (ABC) transporter gene (NpABC1) in N. plumbaginifolia; Mutation in SB3 completely abolished sclareolide-mediated expression	61.90%
Motif_7	3AF1BOXPSRBCS3	3AF1 binding site; tetramer in the light-responsive promoter of pea rbcS-3A gene; Box VI; One of AT-rich sequences which have been found in numerous light-regulated promoters; 3AF1 site includes a GATA motif	61.90%
Motif_148	CArG3 motif in AP3	CArG3 found in the Arabidopsis APETALA3 (AP3) gene promoter; Binding site of AP3/PI heterodimer; Binding site for a negatively acting factors; Binding sequence of Arabidopsis MADS domain homeotic proteins APETALA1, APETALA3, PISTILLATA, and AGAMOUS; AP1, AG, and AP3-PI complexes induce similar conformational changes on a CArG-box sequence; The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects	57.14%
Motif_328	GLUTEBP2OS	Glutelin BP-2; Binding with nuclear factors from developing seeds	57.14%
Motif_449	AGL25; SVP	FLOWERING LOCUS C (FLC) regulates development pathways throughout the life cycle of Arabidopsis. Genome-wide identification of SOC1 and SVP targets during the floral transition in Arabidopsis	57.14%
Motif_44	AGL25	FLOWERING LOCUS C (FLC) regulates development pathways throughout the life cycle of Arabidopsis	57.14%
Matrix_485	SVP; AGL24	Not Available	56.65%
Matrix_428	SEP4	Not Available	56.16%
Matrix_28	SEP1	Not Available	56.13%
Matrix_222	AGL2	DNA binding properties of two Arabidopsis MADS domain proteins: binding consensus and dimer formation	56.13%
Motif_180	AGL2 binding site motif	Binding consensus sequence of Arabidopsis AGL2 (AGAMOUS-like 2); AGL2 contains MADS domain; AGL2 binds DNA as a dimer	55.00%
Motif_152	MEJARELELOX	MeJa-responsive element (MeJaRE) in tomato lipoxygenase (LOX) gene; Related to tomato lipoxygenase gene expression during development and for MeJa (methyl jasmonate)-responsiveness	53.16%
Matrix_417	SEP4	Not Available	52.77%
Matrix_2	SEP4	Not Available	52.77%
Matrix_310	AGL3	The Arabidopsis MADS-box gene AGL3 is widely expressed and encodes a sequence-specific DNA-binding protein	52.77%
Matrix_267	FLM; FLC; MAF2; FCL3; AGL69; AGL68	Not Available	52.69%
Motif_611	PE1ASPHYA3	PE1; Positively acting element found at -381 to -348 of oat phyA3 promoter; A general positive element	52.38%
Motif_35	ASF1NTPARA	ASF-1 (as-1 binding nuclear factor) binding site found in tobacco parA gene; Found in auxin-responsive regions; as-1-like sequences in parA, parB and parC bind with ASF-1, ALF-2, and ALF-1, respectively; See ABFOS,ALF1NTPARC,ALF2NTPARB	52.38%
Motif_417	SITE1SORPS1	Site 1 in the spinach rps1 promoter; S1F binding site; Nuclear genes encoding plastid ribosomal proteins are more highly expressed in leaves than in root; Involved in leaf-specific induction; Seems to be light-independent; Involved in negative regulation; Related to the light-responsive Box II of the pea rbcs-3A promoter; Related to GT elements; S1 box=ATGGTA	52.38%
Motif_78	SITE3SORPS1	Site 3 of spinach (S.o.) rps1 promoter; S1F binding site	52.38%
Motif_185	CArG2 motif in AP3	CArG2 found in the Arabidopsis APETALA3 (AP3) gene promoter; Mutations in CArG2 result in a decrease in the expression in petals, but the expression pattern in stamens is unchanged; The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects	52.38%
Motif_229	D2GMAUX28	D2; DNase I protected sequence found in the soybean auxin responsive gene, Aux28, promoter; Located between -703 and -716; A/T-rich sequence	52.38%
Motif_240	IBOXLSCMCUCUMISIN	I-box-like sequence found in the region (from -254 to -215) of cucumisin (a subtilisin-like serine protease) in the fruit of melon; I-box-like sequence functions as a negative regulatory element	52.38%
Motif_45	AGL25; SOC1	FLOWERING LOCUS C (FLC) regulates development pathways throughout the life cycle of Arabidopsis;Genome-wide identification of SOC1 and SVP targets during the floral transition in Arabidopsis	52.38%
Motif_75	TEFBOXATEEF1AA1	tef-box found in the Arabidopsis eEF1AA1 gene promoter; An activating sequence associated with telo-box; Required for the gene expression in root primordia; Acts co-operatively with telo-box; Plant interstitial telomere mitifs participate in the control of gene expression in root meristems	52.38%
Motif_105	AGL3 binding site motif	The Arabidopsis MADS-box gene AGL3 is widely expressed and encodes a sequence-specific DNA-binding protein	52.38%
Motif_679	SB1NPABC1	Sclareol box1 (SB1) found at -827 of a plasma membrane ATP binding cassette (ABC) transporter gene (NpABC1) in N. plumbaginifolia; Mutation in SB3 completely abolished sclareolide-mediated expression	52.38%
Matrix_123	FUSCA3	Not Available	50.19%