IGR sequence: | igr3097#chr5#x1=15478185#l=2723 |
---|---|
Mature miRNA sequence: | CGGCAAGUCAUCCUUGGCUG |
encoded miRNA: | MIR86 |
Precursor location: | 661 - 874 (positive strand) |
precursor length: | 214 (50 basepairs) |
MIR position: | 195 - 214 (855 - 874) |
MIR length: | 20 (18 paired bases) |
miRNA location TIGR v3: | chr5:15478845>15479058 |
miRNA location TIGR v5: | chr5:15887903>15888116 |
Folding energy: | -58.00 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster008 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UAGCCAUAGA UGACUUGCCG GGCUAGCUUG GUUACACUUC UUGCCCCAAC ACACAUAUAU 60 ((((((--(( (((((((((( (--((((((( ,,,,,,,,,, ,,,,,,,,,, ,,,,<<<<<< AAAUAAGUAA AUACUUUUUC GUAUUAUAUU ACGUACGAAA AAAAAUCAAC UAAAACUAUG 120 <,,,,,,,,, ,,,,[[[[[[ [[[[______ __]]]]]]]] ]],,[[[-[[ _________] UAGAUAAGUA AAUAUAUAUA AACCAUCAUC UCCAUAAUAU AAAUCGAAUA UAGAGUAAUC 180 ]-]]],,,,, ,,>>>>>>>, ,,,,,,,,,, ,,,,,,,,,, ,,,,,,,,,, ,,[[____]] ****** ********** **** AUAAUACAAG CUACCGGCAA GUCAUCCUUG GCUG 214 ,,,,,,)))) )))))))))) ))))))--)) ))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g54150.1 | 68408.m05663 zinc finger (C3HC4-type RING finger) protein family | 2 | 8 |
Rice homologs
- gnl|BL_ORD_ID|430_45524-45617_1-20
- gnl|BL_ORD_ID|430_45523+45617_76-95