IGR sequence: | igr2959#chr2#x1=14390339#l=3764 |
---|---|
Mature miRNA sequence: | UCUGCCAAAGGAGAUUUGCCC |
encoded miRNA: | MIR27b |
Precursor location: | 3137 - 3230 (positive strand) |
precursor length: | 94 (37 basepairs) |
MIR position: | 74 - 94 (3210 - 3230) |
MIR length: | 21 (19 paired bases) |
miRNA location TIGR v3: | chr2:14393475>14393568 |
miRNA location TIGR v5: | chr2:14452088>14452181 |
Folding energy: | -44.40 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster020 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
GGGCAAGAUC ACCAUUGGCA GAGAUCUAUU ACUUCAUUCU UGCAUCAUAU GCAUAAAUGU 60 (((((-(((( -((-(((((( ((((-((((( ((--((((-- (((((___)) )))--))))- ******* ********** **** UUGUGGUGAG CUCUCUGCCA AAGGAGAUUU GCCC 94 --)))))-)) -))))))))) )-))-))))) ))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At2g33770.1 | 68409.m03744 ubiquitin-conjugating enzyme family | 2 | 5 |
2 | At2g33770.1 | 68409.m03744 ubiquitin-conjugating enzyme family | 2 | 5 |
Rice homologs
- gnl|BL_ORD_ID|302_10010-10104_1-21
- gnl|BL_ORD_ID|302_10010+10104_75-95
- gnl|BL_ORD_ID|289_138589-138683_1-21
- gnl|BL_ORD_ID|289_138589+138683_75-95