IGR sequence: | igr2959#chr2#x1=14390339#l=3764 |
---|---|
Mature miRNA sequence: | UCUGCCAAAGGAGAUUUGCC |
encoded miRNA: | MIR67 |
Precursor location: | 1645 - 1727 (positive strand) |
precursor length: | 83 (31 basepairs) |
MIR position: | 64 - 83 (1708 - 1727) |
MIR length: | 20 (18 paired bases) |
miRNA location TIGR v3: | chr2:14391983>14392065 |
miRNA location TIGR v5: | chr2:14450596>14450678 |
Folding energy: | -37.90 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster020 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
GGCGAAUCCU CUAUUGGCAG UGGAAGUUGA UGACCCUUAU AUGUUAUUUU CUCAUCAUUU 60 ((((((((-( ((-((((((( -(((((-((( (((----((_ ____))---- -))))))-)) ******* ********** *** UCCUCUGCCA AAGGAGAUUU GCC 83 )))-)))))) )-)))))))) )))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At2g33770.1 | 68409.m03744 ubiquitin-conjugating enzyme family | 2 | 5 |
2 | At2g33770.1 | 68409.m03744 ubiquitin-conjugating enzyme family | 2 | 5 |
Rice homologs
- gnl|BL_ORD_ID|302_10012-10104_1-20
- gnl|BL_ORD_ID|302_10012+10104_74-93
- gnl|BL_ORD_ID|289_138591-138683_1-20
- gnl|BL_ORD_ID|289_138591+138683_74-93