IGR sequence: | igr2413#chr1#x1=10226044#l=3960 |
---|---|
Mature miRNA sequence: | CUGCCAAAGGAGAUUUGCCC |
encoded miRNA: | MIR27 |
Precursor location: | 1028 - 1126 (positive strand) |
precursor length: | 99 (39 basepairs) |
MIR position: | 80 - 99 (1107 - 1126) |
MIR length: | 20 (19 paired bases) |
miRNA location TIGR v3: | chr1:10227071>10227169 |
miRNA location TIGR v5: | chr1:10227071>10227169 |
Folding energy: | -41.80 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster020 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
GGGUAAGAUC UCUAUUGGCA GGAAACCAUU ACUUAGAUCU UUGCAUCUCU UUAUGCAUUG 60 (((((-(((( (((-(((((( ((-((((((( (-(((((-(- -(((((____ __)))))--) * ********** ********* CUUUUAAUUA GUGAGUUAUC UGCCAAAGGA GAUUUGCCC 99 --)))))-)) )))-)))-)) ))))))-))) )))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At2g33770.1 | 68409.m03744 ubiquitin-conjugating enzyme family | 2 | 5 |
2 | At2g33770.1 | 68409.m03744 ubiquitin-conjugating enzyme family | 2 | 5 |
3 | At2g33770.1 | 68409.m03744 ubiquitin-conjugating enzyme family | 1 | 5 |
4 | At2g33770.1 | 68409.m03744 ubiquitin-conjugating enzyme family | 2 | 5 |
5 | At2g33770.1 | 68409.m03744 ubiquitin-conjugating enzyme family | 2 | 5 |
Rice homologs
- gnl|BL_ORD_ID|560_99071-99164_1-20
- gnl|BL_ORD_ID|560_99071+99164_75-94