IGR sequence: | igr2356#chr3#x1=9872012#l=10062 |
---|---|
Mature miRNA sequence: | AGGCAAGUCAUCCUUGGCUACC |
encoded miRNA: | MIR44 |
Precursor location: | 7445 - 7576 (positive strand) |
precursor length: | 132 (48 basepairs) |
MIR position: | 111 - 132 (7555 - 7576) |
MIR length: | 22 (18 paired bases) |
miRNA location TIGR v3: | chr3:9879456>9879587 |
miRNA location TIGR v5: | chr3:9879446>9879577 |
Folding energy: | -53.71 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster008 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
GAUAGCCAAG GAGACUGCCU GAUGUCUUUU GAUGAGUAAA AUGGUCAUUG CUUGAUAUAA 60 ::(((((((( (((((((((( (---((((-- --(((((((( ((((((((-( -((((((--( ********** CUUAUAGUCA CUUGUCAAAC AUGACACUAA CCCAUUUUAC UCAAAGAAAC AGGCAAGUCA 120 (_____))-- --))))))-) ))))------ -))))))))) )))))))--) ))))-))))- ********** ** UCCUUGGCUA CC 132 )))))))))) ::
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g54150.1 | 68408.m05663 zinc finger (C3HC4-type RING finger) protein family | 3 | 8 |
Rice homologs
- gnl|BL_ORD_ID|2154_158028-158181_1-22
- gnl|BL_ORD_ID|2154_158030+158181_131-152
- gnl|BL_ORD_ID|323_84895+85046_131-152
- gnl|BL_ORD_ID|323_84893-85046_1-22