IGR sequence: | igr2356#chr3#x1=9872012#l=10062 |
---|---|
Mature miRNA sequence: | UGGUAGCCAAGGAUGACUUGCCUGU |
encoded miRNA: | MIR47c |
Precursor location: | 7445 - 7577 (negative strand) |
precursor length: | 133 (52 basepairs) |
MIR position: | 1 - 25 (7553 - 7577) |
MIR length: | 25 (21 paired bases) |
miRNA location TIGR v3: | chr3:9879456<9879588 |
miRNA location TIGR v5: | chr3:9879446<9879578 |
Folding energy: | -61.01 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster006 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ***** UGGUAGCCAA GGAUGACUUG CCUGUUUCUU UGAGUAAAAU GGGUUAGUGU CAUGUUUGAC 60 :((((((((( (((-((((-( ((((--(((( (((((((((( ((-------( (((((((((- AAGUGACUAU AAGUUAUAUC AAGCAAUGAC CAUUUUACUC AUCAAAAGAC AUCAGGCAGU 120 --(((((___ __)))))-)) ))))-))))) )))))))))) )----))))- --)))))))) CUCCUUGGCU AUC 133 )))))))))) )))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g17590.1 | 68408.m01959 transcription factor -related | 4 | 10 |
2 | At1g72830.1 | 68408.m07728 CCAAT-binding factor B subunit homolog -related | 4 | 8 |
Rice homologs
- gnl|BL_ORD_ID|3514_19523-19631_1-25
- gnl|BL_ORD_ID|3514_19523+19631_85-109
- gnl|BL_ORD_ID|3443_19523-19631_1-25
- gnl|BL_ORD_ID|3443_19523+19631_85-109
- gnl|BL_ORD_ID|2878_55661+55769_85-109
- gnl|BL_ORD_ID|2878_55661-55769_1-25
- gnl|BL_ORD_ID|2113_119288-119380_1-25
- gnl|BL_ORD_ID|2113_123475-123580_1-25
- gnl|BL_ORD_ID|2113_130007-130128_1-25
- gnl|BL_ORD_ID|2113_130007+130128_98-122
- gnl|BL_ORD_ID|990_58583-58675_1-25
- gnl|BL_ORD_ID|990_62770-62875_1-25
- gnl|BL_ORD_ID|990_69302-69423_1-25
- gnl|BL_ORD_ID|990_69302+69423_98-122