IGR sequence: | igr2356#chr3#x1=9872012#l=10062 |
---|---|
Mature miRNA sequence: | UAGCCAAGGAUGACUUGCCUGU |
encoded miRNA: | MIR47 |
Precursor location: | 7447 - 7574 (negative strand) |
precursor length: | 128 (50 basepairs) |
MIR position: | 1 - 22 (7553 - 7574) |
MIR length: | 22 (19 paired bases) |
miRNA location TIGR v3: | chr3:9879458<9879585 |
miRNA location TIGR v5: | chr3:9879448<9879575 |
Folding energy: | -57.61 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster006 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ** UAGCCAAGGA UGACUUGCCU GUUUCUUUGA GUAAAAUGGG UUAGUGUCAU GUUUGACAAG 60 (((((((((( -((((-(((( (--((((((( (((((((((- ------(((( ((((((---( UGACUAUAAG UUAUAUCAAG CAAUGACCAU UUUACUCAUC AAAAGACAUC AGGCAGUCUC 120 ((((_____) ))))-))))) )-)))))))) ))))))))-- --))))---) )))))))))) CUUGGCUA 128 ))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g17590.1 | 68408.m01959 transcription factor -related | 3 | 10 |
2 | At1g72830.1 | 68408.m07728 CCAAT-binding factor B subunit homolog -related | 3 | 8 |
3 | At3g05690.1 | 68410.m00583 transcription factor -related | 3 | 1 |
4 | At5g06510.1 | 68412.m00681 transcription factor-related protein | 3 | 1 |
Rice homologs
- gnl|BL_ORD_ID|3514_22769-22903_1-22
- gnl|BL_ORD_ID|3514_22769+22903_114-135
- gnl|BL_ORD_ID|3443_22769-22903_1-22
- gnl|BL_ORD_ID|3443_22769+22903_114-135
- gnl|BL_ORD_ID|2878_52360+52494_114-135
- gnl|BL_ORD_ID|2878_52360-52494_1-22
- gnl|BL_ORD_ID|2113_133632-133719_1-22
- gnl|BL_ORD_ID|990_72927-73014_1-22